ID: 1026319124

View in Genome Browser
Species Human (GRCh38)
Location 7:69253692-69253714
Sequence CCAGAAAACAAGGGCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026319124_1026319131 21 Left 1026319124 7:69253692-69253714 CCAGCTTTGCCCTTGTTTTCTGG No data
Right 1026319131 7:69253736-69253758 AACACAAATTCAAGTGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026319124 Original CRISPR CCAGAAAACAAGGGCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr