ID: 1026319152

View in Genome Browser
Species Human (GRCh38)
Location 7:69253956-69253978
Sequence CTGTATCCACTGCTGTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026319150_1026319152 -4 Left 1026319150 7:69253937-69253959 CCTAAAGAGTTCTGCTCCTCTGT No data
Right 1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG No data
1026319149_1026319152 11 Left 1026319149 7:69253922-69253944 CCTACAAAGCAGAAACCTAAAGA No data
Right 1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026319152 Original CRISPR CTGTATCCACTGCTGTCATT TGG Intergenic
No off target data available for this crispr