ID: 1026322726

View in Genome Browser
Species Human (GRCh38)
Location 7:69281723-69281745
Sequence TGATGCACAAAGCATCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026322726_1026322729 6 Left 1026322726 7:69281723-69281745 CCTAGCTGATGCTTTGTGCATCA No data
Right 1026322729 7:69281752-69281774 TTTAATTATTGCTTACTGAAGGG No data
1026322726_1026322728 5 Left 1026322726 7:69281723-69281745 CCTAGCTGATGCTTTGTGCATCA No data
Right 1026322728 7:69281751-69281773 GTTTAATTATTGCTTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026322726 Original CRISPR TGATGCACAAAGCATCAGCT AGG (reversed) Intergenic
No off target data available for this crispr