ID: 1026326362

View in Genome Browser
Species Human (GRCh38)
Location 7:69314171-69314193
Sequence TACCTTGTGCTGTGAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026326362_1026326366 -2 Left 1026326362 7:69314171-69314193 CCCCTGTCTCACAGCACAAGGTA No data
Right 1026326366 7:69314192-69314214 TAACAGACCAGTGGCTCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026326362 Original CRISPR TACCTTGTGCTGTGAGACAG GGG (reversed) Intergenic
No off target data available for this crispr