ID: 1026335038

View in Genome Browser
Species Human (GRCh38)
Location 7:69386895-69386917
Sequence CCAGTCTGTTAGTGCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026335036_1026335038 13 Left 1026335036 7:69386859-69386881 CCATGTGATCTGTCTACAGACAA No data
Right 1026335038 7:69386895-69386917 CCAGTCTGTTAGTGCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026335038 Original CRISPR CCAGTCTGTTAGTGCACTCC TGG Intergenic
No off target data available for this crispr