ID: 1026341558

View in Genome Browser
Species Human (GRCh38)
Location 7:69438642-69438664
Sequence GCTGCCTGACACTCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026341556_1026341558 -5 Left 1026341556 7:69438624-69438646 CCAGGAACCAACTTCAGGGCTGC No data
Right 1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG No data
1026341551_1026341558 14 Left 1026341551 7:69438605-69438627 CCATAGTGAGTGATAGATCCCAG No data
Right 1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG No data
1026341550_1026341558 26 Left 1026341550 7:69438593-69438615 CCTTCAACTACACCATAGTGAGT No data
Right 1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG No data
1026341555_1026341558 -4 Left 1026341555 7:69438623-69438645 CCCAGGAACCAACTTCAGGGCTG No data
Right 1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026341558 Original CRISPR GCTGCCTGACACTCACATGC AGG Intergenic
No off target data available for this crispr