ID: 1026342714

View in Genome Browser
Species Human (GRCh38)
Location 7:69447933-69447955
Sequence GAGCCAGAGGTGGGTGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026342714_1026342719 -2 Left 1026342714 7:69447933-69447955 CCTAAAGCACCCACCTCTGGCTC No data
Right 1026342719 7:69447954-69447976 TCCCAGGCTCTTATCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026342714 Original CRISPR GAGCCAGAGGTGGGTGCTTT AGG (reversed) Intergenic
No off target data available for this crispr