ID: 1026343418

View in Genome Browser
Species Human (GRCh38)
Location 7:69453549-69453571
Sequence TGGGAATGTGTATGTTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026343418_1026343420 -9 Left 1026343418 7:69453549-69453571 CCAGTTAAACATACACATTCCCA No data
Right 1026343420 7:69453563-69453585 ACATTCCCAGGACTTTCTTCTGG No data
1026343418_1026343421 -8 Left 1026343418 7:69453549-69453571 CCAGTTAAACATACACATTCCCA No data
Right 1026343421 7:69453564-69453586 CATTCCCAGGACTTTCTTCTGGG No data
1026343418_1026343424 4 Left 1026343418 7:69453549-69453571 CCAGTTAAACATACACATTCCCA No data
Right 1026343424 7:69453576-69453598 TTTCTTCTGGGATGATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026343418 Original CRISPR TGGGAATGTGTATGTTTAAC TGG (reversed) Intergenic
No off target data available for this crispr