ID: 1026343961

View in Genome Browser
Species Human (GRCh38)
Location 7:69457946-69457968
Sequence CCACTCTGATTGTGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026343961_1026343964 8 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343964 7:69457977-69457999 GAAATATTTGCAGAATACAAAGG No data
1026343961_1026343967 14 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343967 7:69457983-69458005 TTTGCAGAATACAAAGGGCTGGG No data
1026343961_1026343968 18 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343968 7:69457987-69458009 CAGAATACAAAGGGCTGGGCTGG No data
1026343961_1026343966 13 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343966 7:69457982-69458004 ATTTGCAGAATACAAAGGGCTGG No data
1026343961_1026343972 28 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343972 7:69457997-69458019 AGGGCTGGGCTGGAAGTTGGGGG No data
1026343961_1026343971 27 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343971 7:69457996-69458018 AAGGGCTGGGCTGGAAGTTGGGG No data
1026343961_1026343969 25 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343969 7:69457994-69458016 CAAAGGGCTGGGCTGGAAGTTGG No data
1026343961_1026343970 26 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343970 7:69457995-69458017 AAAGGGCTGGGCTGGAAGTTGGG No data
1026343961_1026343965 9 Left 1026343961 7:69457946-69457968 CCAGGGCAGCACAATCAGAGTGG No data
Right 1026343965 7:69457978-69458000 AAATATTTGCAGAATACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026343961 Original CRISPR CCACTCTGATTGTGCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr