ID: 1026345008

View in Genome Browser
Species Human (GRCh38)
Location 7:69466152-69466174
Sequence ACTCATATGGTGAAGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026345008_1026345013 9 Left 1026345008 7:69466152-69466174 CCATCTGCCTTCACCATATGAGT No data
Right 1026345013 7:69466184-69466206 AAAAACCACAAGCTCGGGCCAGG No data
1026345008_1026345011 3 Left 1026345008 7:69466152-69466174 CCATCTGCCTTCACCATATGAGT No data
Right 1026345011 7:69466178-69466200 AGCAAGAAAAACCACAAGCTCGG No data
1026345008_1026345012 4 Left 1026345008 7:69466152-69466174 CCATCTGCCTTCACCATATGAGT No data
Right 1026345012 7:69466179-69466201 GCAAGAAAAACCACAAGCTCGGG No data
1026345008_1026345015 17 Left 1026345008 7:69466152-69466174 CCATCTGCCTTCACCATATGAGT No data
Right 1026345015 7:69466192-69466214 CAAGCTCGGGCCAGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026345008 Original CRISPR ACTCATATGGTGAAGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr