ID: 1026346358

View in Genome Browser
Species Human (GRCh38)
Location 7:69477616-69477638
Sequence CTGAGTCAGGACTTGAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026346352_1026346358 2 Left 1026346352 7:69477591-69477613 CCTGTAATCCCAGCTACTCTGGA 0: 4262
1: 108644
2: 250127
3: 226643
4: 156630
Right 1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG No data
1026346354_1026346358 -6 Left 1026346354 7:69477599-69477621 CCCAGCTACTCTGGAGGCTGAGT 0: 98
1: 11724
2: 228302
3: 283005
4: 170887
Right 1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG No data
1026346350_1026346358 21 Left 1026346350 7:69477572-69477594 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG No data
1026346355_1026346358 -7 Left 1026346355 7:69477600-69477622 CCAGCTACTCTGGAGGCTGAGTC 0: 67
1: 9787
2: 206675
3: 264964
4: 178387
Right 1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026346358 Original CRISPR CTGAGTCAGGACTTGAATCT GGG Intergenic
No off target data available for this crispr