ID: 1026346479

View in Genome Browser
Species Human (GRCh38)
Location 7:69478780-69478802
Sequence CCACCCTGCCTGGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026346473_1026346479 8 Left 1026346473 7:69478749-69478771 CCTCCCAGAGTGCTGGGATTACA 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346471_1026346479 14 Left 1026346471 7:69478743-69478765 CCTCAGCCTCCCAGAGTGCTGGG 0: 2242
1: 91106
2: 212136
3: 238216
4: 264261
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346475_1026346479 5 Left 1026346475 7:69478752-69478774 CCCAGAGTGCTGGGATTACAGGC 0: 5645
1: 226181
2: 272263
3: 183265
4: 143363
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346476_1026346479 4 Left 1026346476 7:69478753-69478775 CCAGAGTGCTGGGATTACAGGCG 0: 3126
1: 130507
2: 274724
3: 221599
4: 153552
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346468_1026346479 18 Left 1026346468 7:69478739-69478761 CCCGCCTCAGCCTCCCAGAGTGC 0: 1480
1: 65247
2: 182713
3: 235131
4: 276111
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346467_1026346479 21 Left 1026346467 7:69478736-69478758 CCGCCCGCCTCAGCCTCCCAGAG 0: 434
1: 23515
2: 114102
3: 169926
4: 180238
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data
1026346469_1026346479 17 Left 1026346469 7:69478740-69478762 CCGCCTCAGCCTCCCAGAGTGCT 0: 1461
1: 65016
2: 152147
3: 155962
4: 112468
Right 1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026346479 Original CRISPR CCACCCTGCCTGGCCAAAAC AGG Intergenic
No off target data available for this crispr