ID: 1026346967

View in Genome Browser
Species Human (GRCh38)
Location 7:69482805-69482827
Sequence CGGCAAACAGCGGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026346967_1026346976 23 Left 1026346967 7:69482805-69482827 CCGTCCACCACCGCTGTTTGCCG No data
Right 1026346976 7:69482851-69482873 TCCACCCCTCCAGATCCGGCAGG 0: 8
1: 57
2: 126
3: 136
4: 227
1026346967_1026346975 19 Left 1026346967 7:69482805-69482827 CCGTCCACCACCGCTGTTTGCCG No data
Right 1026346975 7:69482847-69482869 GACTTCCACCCCTCCAGATCCGG 0: 21
1: 71
2: 95
3: 106
4: 191
1026346967_1026346978 24 Left 1026346967 7:69482805-69482827 CCGTCCACCACCGCTGTTTGCCG No data
Right 1026346978 7:69482852-69482874 CCACCCCTCCAGATCCGGCAGGG 0: 8
1: 65
2: 125
3: 157
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026346967 Original CRISPR CGGCAAACAGCGGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr