ID: 1026352115

View in Genome Browser
Species Human (GRCh38)
Location 7:69526462-69526484
Sequence CTCTCTCAAATCCCAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026352115_1026352124 28 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352124 7:69526513-69526535 ACCCAGGATGGAGCTGTTACAGG No data
1026352115_1026352117 -3 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352115_1026352120 12 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352120 7:69526497-69526519 GTTCTTGGCTGCACCCACCCAGG No data
1026352115_1026352121 16 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352121 7:69526501-69526523 TTGGCTGCACCCACCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026352115 Original CRISPR CTCTCTCAAATCCCAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr