ID: 1026352117

View in Genome Browser
Species Human (GRCh38)
Location 7:69526482-69526504
Sequence GAGACAGAGCCCTGTGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026352116_1026352117 -4 Left 1026352116 7:69526463-69526485 CCTCAACTGGGATTTGAGAGAGA No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352109_1026352117 23 Left 1026352109 7:69526436-69526458 CCTGCCCTCCTGGGAAGATACAA No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352111_1026352117 18 Left 1026352111 7:69526441-69526463 CCTCCTGGGAAGATACAATAGCC No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352115_1026352117 -3 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352110_1026352117 19 Left 1026352110 7:69526440-69526462 CCCTCCTGGGAAGATACAATAGC No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data
1026352112_1026352117 15 Left 1026352112 7:69526444-69526466 CCTGGGAAGATACAATAGCCCTC No data
Right 1026352117 7:69526482-69526504 GAGACAGAGCCCTGTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026352117 Original CRISPR GAGACAGAGCCCTGTGTTCT TGG Intergenic
No off target data available for this crispr