ID: 1026352120

View in Genome Browser
Species Human (GRCh38)
Location 7:69526497-69526519
Sequence GTTCTTGGCTGCACCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026352116_1026352120 11 Left 1026352116 7:69526463-69526485 CCTCAACTGGGATTTGAGAGAGA No data
Right 1026352120 7:69526497-69526519 GTTCTTGGCTGCACCCACCCAGG No data
1026352112_1026352120 30 Left 1026352112 7:69526444-69526466 CCTGGGAAGATACAATAGCCCTC No data
Right 1026352120 7:69526497-69526519 GTTCTTGGCTGCACCCACCCAGG No data
1026352115_1026352120 12 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352120 7:69526497-69526519 GTTCTTGGCTGCACCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026352120 Original CRISPR GTTCTTGGCTGCACCCACCC AGG Intergenic
No off target data available for this crispr