ID: 1026352124

View in Genome Browser
Species Human (GRCh38)
Location 7:69526513-69526535
Sequence ACCCAGGATGGAGCTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026352115_1026352124 28 Left 1026352115 7:69526462-69526484 CCCTCAACTGGGATTTGAGAGAG No data
Right 1026352124 7:69526513-69526535 ACCCAGGATGGAGCTGTTACAGG No data
1026352116_1026352124 27 Left 1026352116 7:69526463-69526485 CCTCAACTGGGATTTGAGAGAGA No data
Right 1026352124 7:69526513-69526535 ACCCAGGATGGAGCTGTTACAGG No data
1026352118_1026352124 -1 Left 1026352118 7:69526491-69526513 CCCTGTGTTCTTGGCTGCACCCA No data
Right 1026352124 7:69526513-69526535 ACCCAGGATGGAGCTGTTACAGG No data
1026352119_1026352124 -2 Left 1026352119 7:69526492-69526514 CCTGTGTTCTTGGCTGCACCCAC No data
Right 1026352124 7:69526513-69526535 ACCCAGGATGGAGCTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026352124 Original CRISPR ACCCAGGATGGAGCTGTTAC AGG Intergenic
No off target data available for this crispr