ID: 1026357588

View in Genome Browser
Species Human (GRCh38)
Location 7:69572627-69572649
Sequence TACTACTGCACTCCAGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026357587_1026357588 10 Left 1026357587 7:69572594-69572616 CCAAAAGTTAGAGGCTGCAGTGA No data
Right 1026357588 7:69572627-69572649 TACTACTGCACTCCAGCTTTAGG No data
1026357586_1026357588 11 Left 1026357586 7:69572593-69572615 CCCAAAAGTTAGAGGCTGCAGTG 0: 4
1: 85
2: 1589
3: 11740
4: 42054
Right 1026357588 7:69572627-69572649 TACTACTGCACTCCAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026357588 Original CRISPR TACTACTGCACTCCAGCTTT AGG Intergenic
No off target data available for this crispr