ID: 1026358507

View in Genome Browser
Species Human (GRCh38)
Location 7:69581142-69581164
Sequence TTGTTCCAATCCAAGTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026358507_1026358510 -4 Left 1026358507 7:69581142-69581164 CCCTTGGACTTGGATTGGAACAA No data
Right 1026358510 7:69581161-69581183 ACAACACTCCCAGCCTTCCTGGG No data
1026358507_1026358509 -5 Left 1026358507 7:69581142-69581164 CCCTTGGACTTGGATTGGAACAA No data
Right 1026358509 7:69581160-69581182 AACAACACTCCCAGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026358507 Original CRISPR TTGTTCCAATCCAAGTCCAA GGG (reversed) Intergenic
No off target data available for this crispr