ID: 1026360413

View in Genome Browser
Species Human (GRCh38)
Location 7:69597984-69598006
Sequence CGCCAGGGCGTGGAAGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026360413_1026360423 14 Left 1026360413 7:69597984-69598006 CCGGCGGCTTCCACGCCCTGGCG No data
Right 1026360423 7:69598021-69598043 GGCCGCGGCCGACCCCACGCGGG No data
1026360413_1026360417 -7 Left 1026360413 7:69597984-69598006 CCGGCGGCTTCCACGCCCTGGCG No data
Right 1026360417 7:69598000-69598022 CCTGGCGCGCCAACTCTGCCCGG No data
1026360413_1026360418 -1 Left 1026360413 7:69597984-69598006 CCGGCGGCTTCCACGCCCTGGCG No data
Right 1026360418 7:69598006-69598028 GCGCCAACTCTGCCCGGCCGCGG No data
1026360413_1026360422 13 Left 1026360413 7:69597984-69598006 CCGGCGGCTTCCACGCCCTGGCG No data
Right 1026360422 7:69598020-69598042 CGGCCGCGGCCGACCCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026360413 Original CRISPR CGCCAGGGCGTGGAAGCCGC CGG (reversed) Intergenic
No off target data available for this crispr