ID: 1026362450

View in Genome Browser
Species Human (GRCh38)
Location 7:69615161-69615183
Sequence GGGTATTATAGACCACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026362450_1026362456 21 Left 1026362450 7:69615161-69615183 CCCTCTGGTGGTCTATAATACCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1026362456 7:69615205-69615227 AAGAAACATAGTGTGAAGATGGG No data
1026362450_1026362457 29 Left 1026362450 7:69615161-69615183 CCCTCTGGTGGTCTATAATACCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1026362457 7:69615213-69615235 TAGTGTGAAGATGGGCTGTCAGG No data
1026362450_1026362458 30 Left 1026362450 7:69615161-69615183 CCCTCTGGTGGTCTATAATACCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1026362458 7:69615214-69615236 AGTGTGAAGATGGGCTGTCAGGG No data
1026362450_1026362455 20 Left 1026362450 7:69615161-69615183 CCCTCTGGTGGTCTATAATACCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1026362455 7:69615204-69615226 AAAGAAACATAGTGTGAAGATGG 0: 1
1: 0
2: 2
3: 39
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026362450 Original CRISPR GGGTATTATAGACCACCAGA GGG (reversed) Intronic
902248032 1:15134595-15134617 GGGCATTATAGATTACCATAAGG + Intergenic
903773410 1:25778170-25778192 GGGGATTCTGGACCACAAGATGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
909506220 1:76393017-76393039 GGATATTATGGATAACCAGATGG - Intronic
911180105 1:94852923-94852945 ATGTCTTTTAGACCACCAGATGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920925942 1:210341773-210341795 GGGAATTATAGAACTCAAGAGGG - Intronic
922656142 1:227385466-227385488 GGGTATTATTCAGCACTAGAAGG + Intergenic
923463311 1:234226302-234226324 GGGGATCAAAGACCACCAGCTGG - Intronic
924197721 1:241625608-241625630 TGTTATAATAAACCACCAGAAGG + Intronic
1065381462 10:25095685-25095707 CGGTATGATAGAACACCAGGTGG - Intergenic
1071870939 10:89793829-89793851 GGTTATGATTGTCCACCAGATGG + Intergenic
1076378767 10:130011028-130011050 CGTTATTATAAACCACCAGCTGG + Intergenic
1079946843 11:26754047-26754069 CGGTCTAAGAGACCACCAGATGG + Intergenic
1082172206 11:49018521-49018543 GGGGATTACAGCCCAACAGAAGG + Intergenic
1085419411 11:76342771-76342793 GGGTATTATATGGCAGCAGAGGG + Intergenic
1086693555 11:89817439-89817461 GGGGATTATAGCCCAACAGAAGG - Intergenic
1086712591 11:90027130-90027152 GGGGATTATAGCCCAACAGAAGG + Intergenic
1087456340 11:98391715-98391737 AGGTAATATTGACTACCAGAAGG + Intergenic
1088392379 11:109328978-109329000 TGGTATCATAGTCAACCAGAAGG - Intergenic
1089839631 11:121404669-121404691 GAGTATGATAGACCACAATATGG + Intergenic
1090985712 11:131764289-131764311 GTGCTTTATAGAACACCAGATGG + Intronic
1099324706 12:81199934-81199956 AGATATTATAGAACACAAGAAGG - Intronic
1100432802 12:94545826-94545848 GGGCCTTATAGGCCACAAGAAGG + Intergenic
1105840622 13:24251087-24251109 CGCTATTATAGAAAACCAGAAGG + Intronic
1110613340 13:77513741-77513763 GTGTATTAGGGTCCACCAGAGGG + Intergenic
1111739130 13:92180127-92180149 GGGTATCCTGGACCACCACATGG - Intronic
1115584392 14:34795929-34795951 GTGTATTAAAAACCACCAGAAGG - Intronic
1129172311 15:73815740-73815762 GGGTCTTGTAGACCTCCATAAGG - Intergenic
1129283815 15:74507337-74507359 AGGAAATATAGACCAGCAGAAGG - Intergenic
1138956451 16:61976465-61976487 GGGAATTCTAGACCACCAGGAGG + Intronic
1144685232 17:17221726-17221748 GGGTATAAAAGAACACCAGCAGG + Intronic
1157146279 18:45165954-45165976 GGGTGTGATAGACCATCAAAAGG + Intergenic
1158911490 18:62067468-62067490 GGGTATGATTGACCACAAAAGGG - Intronic
1168434124 19:56304000-56304022 GGTTCTCATAGACCACGAGAAGG + Intronic
926428497 2:12762368-12762390 GGGTATTGTAAACCACAAAATGG - Intergenic
942583326 2:177445931-177445953 GGGTATTATGGATCATCAAATGG + Intronic
943027667 2:182649079-182649101 ATGTATTCTAGGCCACCAGAGGG - Intergenic
945537292 2:211033948-211033970 TGGTAATATCTACCACCAGAGGG + Intergenic
946663308 2:222023803-222023825 GGGTACTGGAGACCACCAGAGGG + Intergenic
946704428 2:222444333-222444355 GGGTGCCACAGACCACCAGAAGG - Intronic
1170545843 20:17435340-17435362 GTGTTTCATATACCACCAGATGG - Intronic
1173224330 20:41153067-41153089 GGGTAGTAAAAACCCCCAGAAGG + Intronic
1181018227 22:20083619-20083641 GGGGATTAGAGACCAACAGTGGG - Intronic
1183829104 22:40408671-40408693 AGGTCTTACAGAGCACCAGACGG - Exonic
1184623956 22:45707688-45707710 AGGTATTAGAGACCACTAGAAGG + Intronic
952379620 3:32794780-32794802 ACGTATTATAGACAAACAGAGGG + Intergenic
955808996 3:62766506-62766528 AGGTATTTCAGACCACCAGAGGG - Intronic
959864022 3:111245511-111245533 AGGTCTTATAGACCATGAGAAGG - Intronic
961616278 3:128183948-128183970 GGATACAATAGACCACCAGCAGG + Intronic
963906399 3:150777106-150777128 GGATATTATGCACCCCCAGATGG - Intergenic
969458162 4:7312872-7312894 GGGACTTCTAGACCAGCAGAAGG + Intronic
975243997 4:72097021-72097043 AGGTATTATAGAATACTAGATGG + Intronic
981288826 4:143050384-143050406 TGGTCATATAGACCACCAAAAGG + Intergenic
982359416 4:154503789-154503811 GGGTATATTAGACTACCACAAGG + Intergenic
985784027 5:1884997-1885019 GGGGAGTAGAGACCCCCAGAGGG + Intronic
988427798 5:31083865-31083887 GGGTCTTATATACCACTATAAGG + Intergenic
991130577 5:63118071-63118093 GAGTACTAGAGAACACCAGAGGG - Intergenic
991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG + Intronic
1010349511 6:74855977-74855999 GGGTATTTTATACCATCATAAGG - Intergenic
1026362450 7:69615161-69615183 GGGTATTATAGACCACCAGAGGG - Intronic
1027725138 7:81795099-81795121 GGTTACTATAGACTAACAGAAGG + Intergenic
1039148592 8:34478481-34478503 GGTTATTTTAGAACACGAGAAGG - Intergenic
1040546181 8:48399669-48399691 GGGCATTATAGACAAAGAGAAGG - Intergenic
1044828479 8:96221742-96221764 GGGCATTTTAGACCAGAAGAAGG - Intergenic
1047184861 8:122623775-122623797 GGGTATTATAGACAAATAGCAGG - Intergenic
1047431364 8:124795907-124795929 GACTATTATAAACCACCAGGAGG - Intergenic
1055072060 9:72176464-72176486 GCGTATTTTAGAACACCACATGG + Intronic
1059992502 9:119878503-119878525 GGCTATTCTAGACCAGCAAATGG - Intergenic
1186263340 X:7804772-7804794 AAGTATTATATTCCACCAGATGG - Intergenic
1189297543 X:39929640-39929662 GGGGATTATAAACCACCGCAAGG + Intergenic
1189995385 X:46632538-46632560 GGGGATTAGACACCACCTGAGGG - Intronic
1190783399 X:53620742-53620764 GGGTATTATAGACTCATAGATGG - Intronic
1194120223 X:89952422-89952444 AGGTAAGATTGACCACCAGATGG + Intergenic
1195681836 X:107553058-107553080 TGGTATTATCCACCTCCAGAGGG + Intronic
1196272512 X:113729062-113729084 AGGTATTTTAGACAACCATATGG + Intergenic
1199988997 X:152973849-152973871 AGGGATTAAAGACCACCAGTGGG - Intergenic
1200473085 Y:3609952-3609974 AGGTAAGATTGACCACCAGATGG + Intergenic
1200768147 Y:7098145-7098167 GGGGATTATAAACCACCAGTAGG - Intergenic