ID: 1026363760

View in Genome Browser
Species Human (GRCh38)
Location 7:69627131-69627153
Sequence ATGTAAATACAGAGGAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026363755_1026363760 6 Left 1026363755 7:69627102-69627124 CCAACATTATGTTTAGAAGGAAT 0: 1
1: 0
2: 0
3: 36
4: 726
Right 1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG 0: 1
1: 0
2: 0
3: 32
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026363760 Original CRISPR ATGTAAATACAGAGGAGGCA AGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901174362 1:7287940-7287962 GTCTAACTACAGAGGAGGCTGGG + Intronic
901187198 1:7382151-7382173 ATCTAACTACAGAGGAGGGTAGG + Intronic
901881240 1:12194997-12195019 CTGTAAACACAATGGAGGCAAGG - Intronic
902208448 1:14887134-14887156 ATGGGAAAACAGAGGAGGAAAGG - Intronic
902363702 1:15957194-15957216 AAGTAAAAATAAAGGAGGCAAGG + Intronic
902372433 1:16014945-16014967 ATCTATATACAGATGTGGCATGG + Exonic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
903129694 1:21270746-21270768 TTCAAAATTCAGAGGAGGCATGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904051603 1:27642937-27642959 ATATACATACATAGGAAGCACGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
907222793 1:52919779-52919801 ATGACAGTGCAGAGGAGGCATGG - Intronic
907383807 1:54112577-54112599 ATGGGAGTGCAGAGGAGGCAGGG - Intergenic
907860920 1:58352228-58352250 AGGTTAATTTAGAGGAGGCAGGG - Intronic
908100838 1:60789377-60789399 ATGCAAGTACAGAGGATGCAAGG - Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908429655 1:64043495-64043517 TTTTAAATACAGTGCAGGCATGG - Intronic
909948774 1:81693936-81693958 ATGTAAATACATAGGTGCAATGG + Intronic
910003960 1:82372062-82372084 ATGCAAATACAGTCGAGGAAGGG - Intergenic
910562853 1:88611032-88611054 ATGTAAATAAAAATGAGGGAAGG - Intergenic
913489106 1:119361868-119361890 ATGTAAATGCTGAGAAGACAGGG - Intergenic
914247407 1:145896428-145896450 ACGTGGATTCAGAGGAGGCAGGG + Intronic
915405932 1:155659783-155659805 TTGTGAAAACAGAGGAGGGAAGG - Exonic
915574941 1:156769287-156769309 ATTTAAATACATAGTAGGCTAGG - Intronic
916763839 1:167841373-167841395 ATGTAAAGACAGAGGAAGTGAGG - Intronic
916802942 1:168231610-168231632 AGGAAAAGACAGAGGAGGAAGGG - Intronic
916895993 1:169162551-169162573 ATATAAATACAGGCCAGGCATGG + Intronic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
917423944 1:174893961-174893983 ATGTAATTACAGAGGAAAAAAGG - Intronic
918155964 1:181847028-181847050 ATGTAATTCCAGAGGAGGGTGGG - Intergenic
919467443 1:197939404-197939426 ATCTAAATACAGAAAAGGTAAGG + Intergenic
919674481 1:200367642-200367664 AAGTAAAGAAAGAGGAGTCAGGG + Intergenic
919745508 1:201006066-201006088 ATGTGATTCCAGATGAGGCAGGG + Intronic
920291189 1:204924189-204924211 ATGTGAAAATACAGGAGGCATGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920673311 1:208021361-208021383 ATGAAAGTACAGAGGAGGGGAGG + Intergenic
921837857 1:219796060-219796082 ATGTAAAAAAAGAGGAGAGATGG - Intronic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
924622936 1:245678108-245678130 CTGTAAATAGGAAGGAGGCAGGG + Intronic
1063122565 10:3115074-3115096 AGGCATAAACAGAGGAGGCAAGG + Intronic
1063377108 10:5561085-5561107 CTGTAAACACATAGGATGCAGGG - Intergenic
1063688964 10:8265330-8265352 AGCAAAATACAAAGGAGGCATGG + Intergenic
1065278683 10:24112939-24112961 ATGTGAAAATAGAGGAGGCAGGG + Intronic
1065762525 10:28995438-28995460 ATGTAAATATTGAAGAAGCATGG - Intergenic
1067381117 10:45774284-45774306 ATGTAAGTACAGAGCACCCAAGG - Intronic
1067888814 10:50114913-50114935 ATGTAAGTACAGAGCACCCAAGG - Intronic
1068309538 10:55260318-55260340 AAGCAAATATAGAGGAGGAAAGG + Intronic
1069640883 10:69954827-69954849 ATGTAGTTAAGGAGGAGGCAGGG + Intronic
1071710905 10:88048199-88048221 ATGTAAAATCAGAGGAGACAGGG - Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1072565680 10:96614966-96614988 ATGTAAAAAGAGAGGATGCCAGG + Intronic
1072866694 10:99069569-99069591 ATGTAAATACATAAGAGGGAAGG - Intronic
1072976204 10:100061048-100061070 ATGAAAATAAAGAGGAAGGATGG + Intronic
1073343501 10:102764107-102764129 AAGAAAATACAGAGAAGGCCGGG - Intronic
1073604498 10:104880319-104880341 ATGGAAAGACTGAGGAGGGAAGG - Intronic
1073792265 10:106952436-106952458 ATGTTAATACAGAGGAGGAGTGG - Intronic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1077286913 11:1770953-1770975 ATGGAAATGCAGTGGAGGAAAGG + Intergenic
1080295951 11:30727651-30727673 ATGTAAATACCCAAGAGGCAAGG - Intergenic
1080300039 11:30773978-30774000 ATGAATATACAGAAGAGCCAAGG - Intergenic
1080506952 11:32924266-32924288 ATTTAAAGACAGTGGAGGCCAGG + Intronic
1081627917 11:44666489-44666511 AAGGAAATCCAGAGGAGGGAAGG - Intergenic
1081693836 11:45095602-45095624 ATGTAATTGCAGAGGAGTCTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085688035 11:78642813-78642835 GTTTCAATACAGAGGAGGGAGGG - Intergenic
1085806983 11:79645326-79645348 AGGGAAAGAAAGAGGAGGCAAGG + Intergenic
1085957197 11:81413852-81413874 AAGTTAATACAGAGGTGGAATGG - Intergenic
1087153054 11:94875850-94875872 ATGTGAACACATAGGAGGCATGG - Exonic
1087489170 11:98801423-98801445 ATGTAATTACAGTGGAGGGAGGG - Intergenic
1087489211 11:98801747-98801769 ATGTAATTACAGTGGAGGGAGGG - Intergenic
1088640911 11:111871924-111871946 ACCAAAATACAGAGAAGGCAAGG - Intergenic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1089982265 11:122782078-122782100 TTGTAAATACAAAAGAGGCCAGG + Intronic
1090477204 11:127034130-127034152 ATGAAAATACAGAGTAGGGTGGG - Intergenic
1091715633 12:2774378-2774400 ATGTGAATACAGGGCAGTCAGGG + Intergenic
1091915910 12:4271861-4271883 ATGTAAAGAAAGGGGAGGGAAGG - Intergenic
1092064133 12:5575645-5575667 ATCTAAATACAGAAGATGTATGG + Intronic
1094235676 12:28163126-28163148 ATGAAATAACAGAGGAGGCCAGG + Intronic
1094623429 12:32101386-32101408 ATGTAAATAAAGAAGAGAAAGGG - Intergenic
1096504609 12:52084855-52084877 CTGGAAGTAGAGAGGAGGCAAGG + Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1100707319 12:97215694-97215716 AGCTAAATGCAGAGGAGGCCTGG - Intergenic
1103898031 12:124286769-124286791 ATGAAAATGCAGAGATGGCAAGG - Intronic
1104667373 12:130657048-130657070 ATGTAAAAAAATAGTAGGCATGG - Intronic
1106109188 13:26761588-26761610 TTTTATATCCAGAGGAGGCATGG - Intergenic
1106847733 13:33754465-33754487 ATGTACATACAAAGGAGAGAGGG + Intergenic
1107475441 13:40731274-40731296 AAGAAAAGACAGAGGAGGCCGGG + Intronic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1109341147 13:61060575-61060597 ATGAAAATACAGGTCAGGCACGG - Intergenic
1109895299 13:68679166-68679188 ATGCACATGCACAGGAGGCATGG + Intergenic
1110161575 13:72384709-72384731 ATAAAAGTACAGAGAAGGCAGGG - Intergenic
1110204313 13:72894824-72894846 AAGTAAATACAGATGATCCAGGG + Intronic
1110575819 13:77053770-77053792 AAGAAAATACAGAGGATGAATGG - Intronic
1111865729 13:93765940-93765962 ATGTACTAACATAGGAGGCAAGG - Intronic
1112702787 13:102031042-102031064 ATGTAACTATATGGGAGGCATGG - Intronic
1112980183 13:105374659-105374681 AGGTAAATATAAAGGAGGCCAGG + Intergenic
1113409083 13:110068298-110068320 ATGAAAATTCACAGGAGGAAAGG - Intergenic
1115567895 14:34640411-34640433 ATGTAATTTTAGAGTAGGCAGGG - Intergenic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1117824674 14:59688717-59688739 ATGTGATTACAGAGAAGGCTGGG - Intronic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1121060842 14:90908267-90908289 TTTTAAATTCAGATGAGGCAGGG + Intronic
1121131992 14:91455993-91456015 TTGGAAATGCAGGGGAGGCATGG - Intergenic
1121418728 14:93797532-93797554 ATGGCAAGACAGAGGAGACACGG - Intergenic
1125236502 15:37520271-37520293 ATGTAAAAAGAGAGCAGGGAAGG + Intergenic
1125263283 15:37851474-37851496 ATGTGAGTACAGAGGAGAAAAGG - Intergenic
1125786351 15:42321857-42321879 ATGTAAAAGCAGTGGATGCAGGG + Exonic
1126940721 15:53762365-53762387 GTGTAATGACAGAGGAAGCAAGG - Intronic
1127933545 15:63614118-63614140 ATATAAAGAAAGAGGAGGAAGGG + Intronic
1127983153 15:64048729-64048751 ATGTGCATGCAGAGGAGGGAAGG - Intronic
1128484027 15:68067283-68067305 ATCTAAAAACACAGGGGGCAAGG - Intronic
1129691628 15:77717314-77717336 ACGTAAATACAGTGGAGGTGAGG + Intronic
1129763058 15:78142811-78142833 CTGTTAATAAACAGGAGGCATGG - Intronic
1129930777 15:79408871-79408893 ATGTGAATACAGAGAAGCCGTGG - Intronic
1130111521 15:80969336-80969358 CTGTAAATACCAAGAAGGCAGGG + Intronic
1130179193 15:81607766-81607788 ATGCAAAGAAAGAGGAGGAATGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134885386 16:17786166-17786188 CTGTAAAAACACAGGAGGAATGG - Intergenic
1135606790 16:23832667-23832689 ATATAAAGACAGAGGAGGATGGG + Intergenic
1135935150 16:26773690-26773712 ATGCCAAGACAGAAGAGGCAAGG + Intergenic
1136331454 16:29580509-29580531 ATGTAGAAAGAGAGCAGGCACGG + Intergenic
1138165322 16:54796074-54796096 AAGTGAAAACAGAGGAGCCAGGG + Intergenic
1138863428 16:60788232-60788254 TTTTAGAGACAGAGGAGGCAGGG + Intergenic
1138917513 16:61484909-61484931 ATGTAAATTCCAAGCAGGCAGGG - Intergenic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140023820 16:71265256-71265278 CTGTAAATCCAGTGGAGGAAAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142228697 16:88889382-88889404 AGGAAAAAGCAGAGGAGGCAGGG + Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1143539973 17:7562973-7562995 ATCTGAATCCAGAGGAGGCATGG + Intronic
1143752384 17:9037948-9037970 ATGAGAATAGAGAGGAAGCAGGG - Intronic
1144518220 17:15935095-15935117 ATGTAAATACAGGCCAGGCGCGG - Intergenic
1146041767 17:29461829-29461851 ATGAAAGCACAGAGGAGTCAAGG + Intronic
1146643884 17:34563549-34563571 ATGGAAATACACAAGAGGCAAGG - Intergenic
1148257454 17:46148004-46148026 ATGGTAAAACAGAGGAGGTAGGG + Intronic
1149442863 17:56689972-56689994 ACATAGACACAGAGGAGGCATGG + Intergenic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1149687212 17:58542930-58542952 AGGTAAGGACCGAGGAGGCAAGG + Exonic
1149963005 17:61132708-61132730 TGTTAAATGCAGAGGAGGCAAGG + Intronic
1150051480 17:61968618-61968640 ATTTAAATAAAAAGGAGGCCGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1151520906 17:74628905-74628927 ATGCAAAAGAAGAGGAGGCAAGG + Intergenic
1152106462 17:78332255-78332277 ATGACAACACAGAGGAGGAAGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156841008 18:41609346-41609368 ATGTAAATTCAGAGGGGGGCGGG - Intergenic
1158365789 18:56734202-56734224 CTGATAATACAGAGAAGGCAAGG - Intronic
1158650556 18:59280694-59280716 ATCTGAATACAAAGGAGGCTGGG - Intronic
1158749615 18:60243778-60243800 ATGTAAACTCAGTGAAGGCAGGG + Intergenic
1159306144 18:66645177-66645199 ATGCAACTAAAGAGGAAGCATGG + Intergenic
1162010715 19:7812865-7812887 ATTTAAATACTCAGGAGACAAGG - Intergenic
1162805021 19:13133270-13133292 ATAGAATTACAGAGGAGGCCGGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1164632309 19:29769577-29769599 ATTTAAATCCAGAGGAGTCAAGG - Intergenic
1165678450 19:37749516-37749538 ATGTAAATACATATGAGAAAAGG + Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
1166601715 19:44101538-44101560 ATGTAGTTAGAGAGGTGGCAGGG - Intronic
1168393503 19:56029559-56029581 ATTTAAATACAAATGAGGCCGGG - Intronic
1168683154 19:58330871-58330893 ATGCAAATACGGGGAAGGCATGG - Intronic
924964589 2:63627-63649 ATGGAAAGAAAGAGTAGGCAAGG - Intergenic
925100772 2:1243597-1243619 ATCTAAATACAGAGGACAGATGG - Intronic
925551121 2:5075899-5075921 ATGTAAATACTAAGGAGGATGGG + Intergenic
926180071 2:10634652-10634674 ATATAAATAAAGAAGAGACAAGG + Intronic
926598356 2:14814770-14814792 ATGAAATTTCAGAGGAGCCAGGG + Intergenic
926783493 2:16497673-16497695 GTGCAAATACAGAGGAGAAAGGG - Intergenic
927462882 2:23314114-23314136 ATGTAACTGCACAGGAGGCTGGG - Intergenic
927675243 2:25100785-25100807 AAGAAAATACAGGGGAGGCCGGG - Intronic
928031076 2:27779932-27779954 ATGTAATAACAGAGATGGCAAGG + Intronic
929558653 2:42941870-42941892 ATGCAAGTACAGAGAAGACAGGG - Intergenic
929727063 2:44440906-44440928 ATGTAAGTTAAGAGGAGGAATGG - Intronic
930188164 2:48430618-48430640 TTATAAATACTGAGGAGGAAGGG + Intergenic
930779442 2:55209166-55209188 ATCAAAATAAAGAGGAGGCCGGG - Intronic
931517329 2:63057778-63057800 ATGTAGATAAAGAGGAGGAGGGG - Exonic
931603057 2:64022793-64022815 ATATAAATACAGAGGGGAAAGGG + Intergenic
932229201 2:70068577-70068599 ATGTGAATAGAAAGGAGGTAAGG + Intergenic
933042942 2:77491900-77491922 ATGGTAATAAAGATGAGGCAAGG + Intronic
933104695 2:78309585-78309607 AAGCAAATACAGAGCAGACAGGG - Intergenic
933237778 2:79884531-79884553 ATAGAAAGAAAGAGGAGGCATGG - Intronic
934687143 2:96329543-96329565 AAAAAAATACAAAGGAGGCATGG - Exonic
935579988 2:104748324-104748346 ATGGAAATATAGAGGCGGCACGG - Intergenic
937627953 2:124064950-124064972 ATGTAAGTACAGAGGGGTCACGG - Intronic
938621602 2:133060589-133060611 ATTTAAATAAAAAGGGGGCAAGG - Intronic
938876649 2:135538226-135538248 ATGTAAATAAAGACAAGGTATGG + Intronic
939344894 2:140951223-140951245 AAATATATACAGAGGAGCCAAGG - Intronic
941284834 2:163597713-163597735 AGAAAAATACATAGGAGGCAAGG - Intronic
941540489 2:166776975-166776997 ATGTATATAGAGAAGAGGCAGGG + Intergenic
942371944 2:175294764-175294786 ATGTAGAGATGGAGGAGGCACGG - Intergenic
943055782 2:182977191-182977213 ATCTAAATACAATGGAGGCCGGG + Intronic
943060831 2:183039811-183039833 ATTTTAATTTAGAGGAGGCAAGG + Intergenic
945661830 2:212695748-212695770 ATCTAAATATAGATGAGGTATGG + Intergenic
945726389 2:213475947-213475969 ACTTAAATGCAGAGGAGGGAAGG + Intronic
946355689 2:219182909-219182931 ATGAGAATAGAGATGAGGCAGGG - Exonic
946782427 2:223205378-223205400 ATGCAAGCACACAGGAGGCAGGG - Intergenic
946988333 2:225300312-225300334 CTGGAAAGACTGAGGAGGCATGG + Intergenic
947281706 2:228462512-228462534 ATATAAAAAGAGAAGAGGCAAGG + Intergenic
947526382 2:230878994-230879016 ATTTCAGAACAGAGGAGGCAGGG - Exonic
1170157094 20:13278870-13278892 ATGTAAAGAGAGAGGCTGCATGG - Intronic
1170854766 20:20041339-20041361 ATATAAATTCAGAGAAGGCTAGG - Intronic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1172849020 20:37947295-37947317 ATCTGAAGACAGAGGATGCAAGG - Intergenic
1173601865 20:44301022-44301044 ATGTAGAGAAAAAGGAGGCAGGG + Intergenic
1173869958 20:46335136-46335158 ATTAAAACACAGAGGAGGGAAGG - Intergenic
1174046112 20:47735060-47735082 ATGGGAATTCAGAGGGGGCATGG - Intronic
1174856219 20:54047890-54047912 ATGTAAATGAAGAGGATGAAGGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177425512 21:20917685-20917707 ATGTAACTACAGAAAAGACAGGG + Intergenic
1177452182 21:21284308-21284330 ATGCAAATATAGAAGATGCAGGG + Exonic
1177821004 21:26030948-26030970 ATGTAAATACCAGGAAGGCAGGG - Intronic
1178378376 21:32087611-32087633 ATGTAACCTCAGAGGAGGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178896849 21:36565836-36565858 ATGGAAATTCAGAAGAGCCAAGG + Intronic
1179162309 21:38908649-38908671 ATGTAAGTACTCAGAAGGCAAGG + Intergenic
1179254222 21:39700834-39700856 TTCTAGATTCAGAGGAGGCAAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182018007 22:27056833-27056855 ATGTAAGTACCAAGCAGGCAGGG + Intergenic
1183855965 22:40635448-40635470 ATGTAAAAACATACGAAGCATGG + Intronic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949727733 3:7069644-7069666 ATGTCCATACACAGTAGGCAGGG + Intronic
949741063 3:7235195-7235217 ATGGAAATACAAAGGAAGGAAGG - Intronic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950820743 3:15755631-15755653 ATGGAGATACAGGGGAGGCAGGG + Intronic
950840099 3:15959736-15959758 AAGAAAATACAGAGCAGGCCTGG + Intergenic
950884478 3:16351145-16351167 ATGTAAATACAATAGAGGAATGG + Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
953521421 3:43646803-43646825 ATGTAAAGAAAGAAGAGGCCAGG - Intronic
954042668 3:47901169-47901191 ATGGAAATACAGAGCAGAAAGGG - Intronic
954777939 3:53036699-53036721 ATGTAAATAGAAAGAAGGGAAGG + Intronic
954804421 3:53208489-53208511 GAATAAATACAGAGGAGGGATGG + Intergenic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
955750673 3:62183267-62183289 ATGTCAGTACAGAGTAGGCCGGG + Intronic
958425738 3:93976977-93976999 ATAGAAATCCAGAGGAGGAATGG + Intergenic
959172833 3:102863518-102863540 ATGGAAATATAGAGGAAGAATGG + Intergenic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
963108789 3:141668120-141668142 ATGTACATACATATTAGGCAAGG + Intergenic
963372817 3:144423172-144423194 ATCCAAATACAGGGGAGCCAGGG + Intergenic
963678409 3:148343918-148343940 ATGTACAGACAGAGGGTGCATGG - Intergenic
965656147 3:170987434-170987456 AGGTAAACACTGATGAGGCATGG - Intergenic
966051231 3:175619488-175619510 ACTTAAATGCAGAGGAGGGAAGG + Intronic
966248666 3:177837524-177837546 AGGCAAATGGAGAGGAGGCAGGG - Intergenic
967211640 3:187175333-187175355 ATGTAAAAACAGCCTAGGCATGG + Intronic
968037846 3:195563341-195563363 AGGTACAGACAGGGGAGGCATGG + Intergenic
968168680 3:196490442-196490464 AAGAAAATCCAGAGGCGGCAGGG + Intronic
968201115 3:196756272-196756294 ATCTATATACAGAGGACACAGGG - Intronic
970374558 4:15443673-15443695 ATCTAGAGACAGAGGAGGCCTGG + Exonic
970867858 4:20779731-20779753 ACATACATACAGAGGAGGAAGGG + Intronic
972092900 4:35310802-35310824 ATGTAAAAACATAAGTGGCAAGG + Intergenic
973551691 4:52041694-52041716 ACGTGACTACAGAGGAGTCAGGG + Intergenic
973551777 4:52042682-52042704 ATGTGACTACAGAGTAGTCAGGG - Intergenic
973703249 4:53556798-53556820 AGCTAATTACAAAGGAGGCACGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975383692 4:73730982-73731004 GTGGAAATAATGAGGAGGCACGG - Intergenic
975658655 4:76666730-76666752 AAGGAAATACAGAGCAAGCAGGG + Intronic
976540408 4:86267840-86267862 ATATAAAAACAGAAGAGGAAGGG - Intronic
977115742 4:93025098-93025120 AAGTAAAGAAAGAGGAGGGAGGG + Intronic
977570469 4:98623851-98623873 ACGTGAATACAGAGGAAACATGG - Intronic
978491212 4:109314083-109314105 ATTTAAATGCAGAGGAGGGAAGG - Intergenic
979484228 4:121252541-121252563 AGGAAAATACTGAGGATGCAGGG + Intergenic
981230777 4:142352675-142352697 ATGTAATTAGAGAGGTGGAAGGG - Intronic
981310038 4:143288851-143288873 ATGTGAATAAAAAGGAGGGAGGG - Intergenic
982574034 4:157085785-157085807 ATGAAAATACAGGCCAGGCACGG - Intronic
982965452 4:161901145-161901167 ATGTAAATTCAGAAAGGGCAAGG - Intronic
983115631 4:163812583-163812605 TTGTAAATTCAGAAGAGACAGGG - Intronic
984391539 4:179140133-179140155 AGAAAAATACAGAGGAGTCAAGG - Intergenic
984927559 4:184819894-184819916 ATGGCAATACTGAGAAGGCAAGG + Intronic
985392339 4:189503450-189503472 ATGTGAGTACAGAGGTGGCCAGG - Intergenic
985396212 4:189547044-189547066 ATATAAATACAGGCCAGGCATGG - Intergenic
987512504 5:18857781-18857803 TTCTAAATGCAGAGGAGGCTTGG + Intergenic
988235781 5:28542185-28542207 TTGTTCACACAGAGGAGGCAAGG + Intergenic
989141983 5:38210585-38210607 ATGTAGAAAGAGAGGAGGAAAGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989235558 5:39144347-39144369 TAGGAAATACAGAGGAGACAGGG + Intronic
989552704 5:42755109-42755131 TTGGAAGTACAGATGAGGCAGGG + Intergenic
990669659 5:58113691-58113713 ATGTAAATGCAGGGGAGAAATGG - Intergenic
991068934 5:62455638-62455660 ATTTTAACACAGAGGAGGAAAGG - Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991301301 5:65131894-65131916 ATTTAAATAGAGAGGAGGCCAGG - Intergenic
992761548 5:79955179-79955201 GTGTAAATAGAGAAGAGGCAGGG - Intergenic
993296116 5:86143422-86143444 ATGTAAATACAGTGTATGTAAGG - Intergenic
993723067 5:91340937-91340959 AAGAAAATAAAGAGGAGGCCGGG + Intergenic
994012972 5:94929158-94929180 ATGTACCTACAGAGGAAGAAAGG - Intronic
994144423 5:96377453-96377475 ATCTAAATATAGAAAAGGCATGG - Intergenic
994227357 5:97268361-97268383 ATTTAAAAAAAGAGGAGGGAGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995057666 5:107778248-107778270 ATGTAAACCCTGAGAAGGCAGGG - Intergenic
996409426 5:123141936-123141958 ATTTAAATGAAAAGGAGGCATGG - Intronic
996559321 5:124811677-124811699 ATGGCAAAGCAGAGGAGGCAAGG + Intergenic
996995375 5:129689713-129689735 ATGTAAAAACAGGCCAGGCACGG - Intronic
997618412 5:135269288-135269310 ATGTAAAGCCAGAGTAGGAAGGG - Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
997930113 5:138065803-138065825 AAGTAAAAACACAGGAGCCAAGG + Intergenic
998193376 5:140045039-140045061 ATGGCAATACAGAGGAGGAAGGG - Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1003024272 6:2539766-2539788 ATGTAAATAGAAAGGAGGTAAGG + Intergenic
1005353339 6:24958868-24958890 AAGCTAAGACAGAGGAGGCATGG - Intronic
1005435134 6:25801743-25801765 ATGTAAAGGCAGAGTAGGAATGG - Intronic
1005575539 6:27186034-27186056 ATCTGAATACAGAGGGGGAAAGG - Intergenic
1005784697 6:29231472-29231494 AGGAAAAGTCAGAGGAGGCATGG + Intergenic
1006692409 6:35900475-35900497 ATGTAAACACAGTGAAGGCAGGG - Intronic
1006756716 6:36422663-36422685 ATGTATATCTAGAGGAGGAAGGG + Intronic
1007178478 6:39912214-39912236 ATGAGAACACAGAGGTGGCAAGG + Intronic
1010163213 6:72883644-72883666 TTGTATATACACAGGAGCCAGGG + Intronic
1012635573 6:101535446-101535468 ATGTAAATAAAGTAGAGGCTAGG + Intronic
1012673415 6:102085698-102085720 TTGTAAATATATATGAGGCAAGG + Intergenic
1015207745 6:130659602-130659624 ATGTAAAACAAGAGTAGGCAAGG - Intergenic
1015402167 6:132798878-132798900 ATGTAGACACAGAAAAGGCAGGG + Intergenic
1016267305 6:142247315-142247337 ATATAACTACAGAGTAGGGAAGG - Intergenic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1017087172 6:150724300-150724322 ATCTAAAGGCAGAGGAGGCTGGG + Intronic
1017801299 6:157898735-157898757 ATGTGCTTACAGAGGAGACAGGG - Intronic
1018866324 6:167749144-167749166 AAGTTATTACAGAGGAGGCCAGG + Intergenic
1019068801 6:169325000-169325022 AGGTGCATACAGAGGAGGCCAGG + Intergenic
1019601738 7:1887137-1887159 ATCTGGATCCAGAGGAGGCAGGG - Intronic
1019718154 7:2551398-2551420 ATTTAAATACAGGCCAGGCATGG + Intronic
1020887138 7:13832237-13832259 ATGTAACTTTAAAGGAGGCAGGG - Intergenic
1022740548 7:33116236-33116258 ATGGATATAGAGAGGAGGGAAGG - Intergenic
1023452131 7:40298055-40298077 AAGGAAACACAAAGGAGGCAAGG - Intronic
1024023084 7:45388452-45388474 AAGTAAATACAGACCAGGCTGGG - Intergenic
1024042056 7:45563586-45563608 AGGTACATATAGAGAAGGCAAGG + Intergenic
1025763649 7:64419338-64419360 ATATAAAGACACAGGAAGCATGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1027385416 7:77654961-77654983 ATTTAAATAAAAAGGAGGCTGGG - Intergenic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1032554442 7:132817034-132817056 AGGTAAAGACAGAGAAGACAGGG - Intronic
1032918972 7:136524773-136524795 ATGTAAATACAGAAAAGGGATGG + Intergenic
1034588853 7:152121475-152121497 ATGGAAATCCAGAGGAGAGATGG - Intronic
1036129809 8:6098588-6098610 TTGTTCATACAGAGAAGGCAGGG - Intergenic
1038172761 8:25152598-25152620 ATGTACATACAGAGAAAGAAAGG + Intergenic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1040621523 8:49097370-49097392 ATGCAAAAGGAGAGGAGGCAGGG + Intergenic
1040724300 8:50363269-50363291 ATGTAAATTCAGGTAAGGCAGGG - Intronic
1041842316 8:62286349-62286371 ATATAAATACAAAAGAGTCAAGG - Intronic
1043043587 8:75293387-75293409 ATGAAAATACAGAAGTGGCCGGG + Intergenic
1044445520 8:92270591-92270613 ATTTAAGTTCAGAGGAGGTATGG + Intergenic
1044845904 8:96380895-96380917 ATGTAATTGGAGAGGAGGCTTGG + Intergenic
1045604964 8:103762916-103762938 ATTTAAATATAGAAAAGGCATGG + Intronic
1046313097 8:112464519-112464541 ATGTAACTTCAGAGGAGGGAAGG - Intronic
1050069671 9:1797615-1797637 CTGTAATAACAGAGAAGGCAAGG + Intergenic
1050965670 9:11798281-11798303 ATGTAAAAACAGAGGACTTAAGG + Intergenic
1051062805 9:13064668-13064690 ATTTAAGTACAGAGGACTCAGGG - Intergenic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1051477072 9:17519559-17519581 TTGTAAATACATGGGATGCAGGG + Intergenic
1053431538 9:38044912-38044934 ATGTGTACACAGAGGAGGGAGGG + Intronic
1055633329 9:78247409-78247431 ATGTAGTTACATAGGTGGCAGGG + Intronic
1055759525 9:79591724-79591746 ATGGAAATGCATAGGAGGAAAGG + Intronic
1055779311 9:79802224-79802246 ATGTATAAATAGAGGAGGAAAGG - Intergenic
1055808577 9:80124875-80124897 AAGGAAAGACAGAGGAGCCATGG - Intergenic
1058105663 9:100968538-100968560 TTGTTAACACTGAGGAGGCAGGG + Intergenic
1059822773 9:117992370-117992392 GTGGAAATGGAGAGGAGGCAGGG + Intergenic
1060711124 9:125865101-125865123 ATTTAAATACTGATGTGGCATGG - Intronic
1060773884 9:126354708-126354730 ATATAAATACAGAGAAAGAAGGG + Intronic
1062100085 9:134723441-134723463 ATGTGGAGACAGGGGAGGCAGGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1062679739 9:137772509-137772531 GTGTAAATACAGAGCTGGCGAGG - Intronic
1186172349 X:6890806-6890828 ATGGAAATACAGTCCAGGCATGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187208613 X:17207053-17207075 AAGTTAATTCAGAGAAGGCAAGG - Intergenic
1190118594 X:47641956-47641978 ATGTGATGACAGAAGAGGCAGGG + Intronic
1191991968 X:67047867-67047889 ATGTAACTACAGAGGGGATAAGG - Intergenic
1193044255 X:77034700-77034722 ATGAAAACACCCAGGAGGCAGGG + Intergenic
1194265304 X:91745867-91745889 AAGGAAATACAGAGAAAGCACGG - Intergenic
1194411431 X:93563262-93563284 AAGTAAATACATAGTGGGCATGG + Intergenic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1195291687 X:103435987-103436009 GTGCAAATAAAGAGAAGGCAGGG + Intergenic
1196533019 X:116811954-116811976 ATGAAAACTCAGAGGTGGCATGG - Intergenic
1196885023 X:120236227-120236249 AGGCATAGACAGAGGAGGCAAGG - Intergenic