ID: 1026366040

View in Genome Browser
Species Human (GRCh38)
Location 7:69649459-69649481
Sequence AAGGAGGCACAACTGGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026366040_1026366044 22 Left 1026366040 7:69649459-69649481 CCGTGGTCCAGTTGTGCCTCCTT 0: 1
1: 1
2: 1
3: 32
4: 241
Right 1026366044 7:69649504-69649526 TCACTGTATGCTTTTTTTTTTGG No data
1026366040_1026366045 29 Left 1026366040 7:69649459-69649481 CCGTGGTCCAGTTGTGCCTCCTT 0: 1
1: 1
2: 1
3: 32
4: 241
Right 1026366045 7:69649511-69649533 ATGCTTTTTTTTTTGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026366040 Original CRISPR AAGGAGGCACAACTGGACCA CGG (reversed) Intronic
900009575 1:94024-94046 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
900025685 1:270601-270623 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
900035450 1:404363-404385 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
900057071 1:640113-640135 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
903918212 1:26779995-26780017 AAGGAGGAGGAACAGGACCAAGG + Exonic
904111301 1:28128601-28128623 CAGGAGGCAAAACTGGTCCTGGG + Intergenic
904574889 1:31499002-31499024 AAGGAAGAACAGCTGGTCCAAGG + Intergenic
905105250 1:35559923-35559945 AAGGTGGCAGAAATGGATCAGGG + Intronic
906096476 1:43227658-43227680 AAGCAGGATCAACTGGACAAGGG + Intronic
906234141 1:44193627-44193649 AAGAAAGCACAAATGTACCAGGG + Intergenic
907754096 1:57293123-57293145 AAGGAGGCACGACTCTAGCAGGG + Intronic
908605666 1:65793887-65793909 AAGGAGGCAAAACAGGAAGATGG - Intronic
910511274 1:88007988-88008010 AAGGAGGCACCACAGAGCCAGGG + Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
914327602 1:146635534-146635556 AAGGAGGCCCAAATGGAAGATGG - Intergenic
919586502 1:199447154-199447176 AAGGGTGCAGAACTGGACAAAGG - Intergenic
922257988 1:223909918-223909940 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
922847704 1:228702424-228702446 CAGGAGGCAAAGCTGGGCCAGGG + Intergenic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
924094113 1:240533555-240533577 GAGGAGGCACAACTGGGACAAGG + Intronic
924270834 1:242330957-242330979 AAGAAGGGGAAACTGGACCAGGG - Intronic
924428176 1:243972893-243972915 AAGGGGGAGCAACTGGGCCAAGG + Intergenic
1065077734 10:22097996-22098018 AAGGAAACACTACTGGATCATGG - Intergenic
1066714114 10:38267899-38267921 AAGAAGGGGAAACTGGACCAGGG + Intergenic
1067093916 10:43286051-43286073 AAGGAGCCACAGCTGGCCCTGGG + Intergenic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1071474873 10:86017554-86017576 GAGCAGGCACAACTGGGTCATGG + Intronic
1071956887 10:90770178-90770200 AAGGAGGCAGAGCTGGGCCCAGG + Intronic
1073037145 10:100572049-100572071 AATGGGGCACACCTGGCCCAGGG - Intergenic
1073071780 10:100798859-100798881 ACGGCGGCACAGCAGGACCAGGG - Intronic
1076389705 10:130090256-130090278 ATGGAGGGACAACTGAAGCAGGG + Intergenic
1077448984 11:2623152-2623174 AAGCAGGCACATCTTTACCATGG - Intronic
1079420573 11:20283421-20283443 CAGGAGGCAAAGTTGGACCAGGG + Intergenic
1080196053 11:29610345-29610367 AAAGAAGCAGAACTGGATCATGG - Intergenic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1082722364 11:56694198-56694220 AAGGAGGCACAATTTTAACAGGG + Intergenic
1084195327 11:67521232-67521254 AAGGAGGGATGATTGGACCAAGG - Intronic
1084392488 11:68887147-68887169 CAGGAGGCAGAGCTGGGCCAGGG + Intergenic
1086301638 11:85432297-85432319 AAGGGTGCAGAACTGGACGAAGG + Intronic
1087023629 11:93628347-93628369 AAGGAGGGACAACTCGAAGAGGG - Intergenic
1089940810 11:122414847-122414869 CAGGAGGCATAGCTGGACCTGGG + Intergenic
1090700346 11:129289317-129289339 AAGGAGGGACAACTGTGCCACGG + Intergenic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091177400 11:133574149-133574171 AAAGAGTCTCAAGTGGACCAGGG - Intergenic
1091251589 11:134148466-134148488 AAGGAGGCACAGCAGGGCCAGGG + Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091696120 12:2629380-2629402 CAGGAAGTACCACTGGACCATGG + Intronic
1093465766 12:19447119-19447141 AAGGATGCGCCACTGGACCTGGG + Intronic
1093502818 12:19831916-19831938 AAGGAGGAACAACTAGAGGATGG - Intergenic
1094329024 12:29272650-29272672 AAGGATGCAGAACTGGACGGAGG - Intronic
1097086097 12:56469493-56469515 AGGCAGGCACCACTGGACCCCGG - Exonic
1097979326 12:65720804-65720826 AAGGAGGCACATCTGGTCCCGGG + Intergenic
1098315299 12:69186201-69186223 AAGGTGGGACAACTGAAGCAGGG - Intergenic
1101054042 12:100894257-100894279 AAGGAGGCATGACAGGGCCAAGG + Intronic
1103140201 12:118541538-118541560 AACGAGGCACAACTCGATCCAGG + Intergenic
1104002587 12:124869482-124869504 AAGGAGGCACAGCTGGCTCCTGG + Intronic
1105957205 13:25295138-25295160 GAGGAGGTACACCTGGCCCAAGG + Intergenic
1107036743 13:35910124-35910146 AAGGAGACAAAACAGGACCCAGG + Intronic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1111683668 13:91475608-91475630 AAGCAGACACAACTGCTCCAGGG + Intronic
1111884516 13:94003017-94003039 AAAGAGGCAAAAATTGACCAAGG + Intronic
1114731080 14:24993513-24993535 AAGGAGGCAAAACTGGGCACTGG - Intronic
1115861002 14:37686442-37686464 AAGGATGCACAACTAGTACATGG + Intronic
1117506966 14:56413917-56413939 AAGGAAGCAGAACTGGGCCAAGG - Intergenic
1119651075 14:76383612-76383634 AAGGAGGGACAAAAGGACAAGGG - Intronic
1121236665 14:92396428-92396450 AAGGAGGAACAACAGCACCTTGG - Intronic
1122821190 14:104345992-104346014 AAGGAGGCAGCCCTGGACCCTGG - Intergenic
1122870200 14:104634930-104634952 AGGGAGGGCCAACGGGACCAGGG + Intergenic
1124664040 15:31576506-31576528 AAGGTGGGACAACTTGACCTGGG - Intronic
1128321261 15:66696192-66696214 AAAGTGGACCAACTGGACCAAGG - Intergenic
1129987501 15:79931344-79931366 AGGGAGGCACATCTGGAGGAAGG - Intergenic
1136113212 16:28078031-28078053 AAGGAGGCAAAAGTGGAGCCTGG + Intergenic
1136237865 16:28925470-28925492 GAGGAGGCATAATTGGAGCAGGG - Exonic
1136284476 16:29233064-29233086 CAGGAAGCACATCTGGTCCAAGG + Intergenic
1136749100 16:32616857-32616879 ATGGAGGAAGAACTGGACCTGGG - Intergenic
1140005957 16:71075406-71075428 AAGGAGGCCCAAATGGAAGATGG + Intronic
1140111311 16:72007890-72007912 CAGGAGGCACAACAGGCGCAGGG + Intergenic
1140114658 16:72031138-72031160 AAAGAGGCAAAACTGGGCCAGGG + Intergenic
1140350381 16:74256923-74256945 GAGAAGACACAACTGGCCCAGGG + Intergenic
1141882076 16:86866908-86866930 AAGGAGGAAGAAGAGGACCAGGG - Intergenic
1142089513 16:88202577-88202599 CAGGAAGCACATCTGGTCCAGGG + Intergenic
1142454754 16:90212878-90212900 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1203051233 16_KI270728v1_random:876071-876093 ATGGAGGAAGAACTGGACCTGGG - Intergenic
1143253772 17:5540999-5541021 GAGGAGGCCCAGCAGGACCAGGG + Intronic
1144947526 17:18977573-18977595 AAGGAGGCACAGGTGGGTCAGGG - Exonic
1145007632 17:19346469-19346491 AGTGAGGCACAAGTGGAACATGG - Intronic
1148567884 17:48644465-48644487 AAGGAGGTACCACTGGATCTTGG + Intergenic
1149519194 17:57305391-57305413 AAGAAGGCACAACTGGCTCCGGG - Intronic
1149559151 17:57595823-57595845 AAGGTGGTAGAACTGGACCCTGG - Intronic
1150528952 17:65956848-65956870 AAGGAGGGACTACTGTACCTAGG - Intronic
1151223084 17:72627967-72627989 CAGGAGACAAAACTGAACCAGGG + Intergenic
1151507924 17:74541603-74541625 AAGCAGGCAGAATTGGCCCAAGG - Exonic
1153529243 18:6027394-6027416 AATGTGGCACATATGGACCATGG - Intronic
1155482660 18:26306087-26306109 AAGGAGGCAAACATGGAGCACGG - Intronic
1156256663 18:35404355-35404377 AATGTGGCACATATGGACCATGG - Intergenic
1157267578 18:46241310-46241332 GAGGAGAAACAACTGGTCCAAGG - Intronic
1157679878 18:49596754-49596776 AAGGGGGCACCAGGGGACCAGGG - Exonic
1161381278 19:3966367-3966389 AAGGGGACACGACTGGACCTGGG + Intronic
1161818008 19:6511807-6511829 AAGGAGGGACAACTGGAAACAGG - Intergenic
1162427035 19:10602930-10602952 AAGGAGGAAGAAATGGACAAAGG - Intronic
1164813588 19:31177182-31177204 AAGGATGCATCAATGGACCATGG + Intergenic
1166182140 19:41116536-41116558 AAGGAGGCCCTGGTGGACCAGGG + Exonic
1167659157 19:50785877-50785899 AAGATGACAGAACTGGACCAGGG + Intergenic
1167670482 19:50850162-50850184 AAGGGGGGACCACTAGACCAGGG + Intergenic
925052084 2:823466-823488 AAGGAGGGACAACAGGAGAAGGG + Intergenic
925456814 2:4023124-4023146 AGGGAGGCACAAAGGGACCCAGG - Intergenic
925792921 2:7510895-7510917 AAGGAGGCACCACTAGCCCTAGG - Intergenic
926112931 2:10194367-10194389 GAGGAGGCACGGCAGGACCAAGG - Intronic
927603351 2:24463679-24463701 GATGAGGCACAACTGGCTCATGG - Intergenic
927619834 2:24642758-24642780 ACTGTGGCACAACTGTACCATGG + Intronic
927886961 2:26724636-26724658 GAGGAGGCACATCTAGGCCAGGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929047154 2:37801165-37801187 CACGAGGGGCAACTGGACCAGGG + Intergenic
929628897 2:43437994-43438016 AAGGATGCTCAACTATACCAAGG + Intronic
931309193 2:61062681-61062703 AAGGAGGAACATCTGTACAATGG + Intergenic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
933834171 2:86232296-86232318 CAGCAGGCACAACTGGACCTGGG - Intronic
934474706 2:94586576-94586598 AAGGAGCCACAGCTGGATCGGGG - Intergenic
935432806 2:102994537-102994559 AAGGAGGCAAAACTAAACTATGG - Intergenic
936670910 2:114654809-114654831 TGGAAGGCACAACTGGACTAGGG + Intronic
937064519 2:119007088-119007110 AAGGAGGCACAATTTGTCCTGGG - Intergenic
939159761 2:138574093-138574115 AAGGAAGCACAACAGGACAACGG - Intergenic
939235335 2:139485123-139485145 AAGGTGGGACAACTGGAAGAGGG - Intergenic
939672196 2:145026157-145026179 AAGAAGGTACACCTAGACCAGGG - Intergenic
940896880 2:159089473-159089495 AATGAGGCAGGACAGGACCAAGG - Intronic
942310295 2:174650159-174650181 AAGGGGGCACAGCTGTACCTGGG - Intronic
946195649 2:218031982-218032004 AAGGAGGCACGACTGGCACCCGG + Intergenic
946287898 2:218719186-218719208 TAGGAGGCCAAACTGGACCAGGG + Intronic
946461814 2:219875629-219875651 AAGGCGGGACAACTGGACGGGGG + Intergenic
948565349 2:238882900-238882922 CAGGGGGCACACCTGGACCACGG - Intronic
949086215 2:242157537-242157559 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1169566667 20:6861372-6861394 GAGGAGGCACTACTGGATCAAGG + Intergenic
1169999662 20:11601189-11601211 TAGGAGGCACAAGGGGAACATGG + Intergenic
1170003999 20:11646487-11646509 GAGGAGGCACAGCTGGGTCAAGG + Intergenic
1170129517 20:13003605-13003627 AATGAGGCAGAACTGATCCATGG + Intergenic
1170627528 20:18041062-18041084 AAGGTGGCTCACCTGGCCCAAGG + Intronic
1170843187 20:19940455-19940477 AGGGAGGCACAACTGGAGACTGG - Intronic
1171814574 20:29773484-29773506 AATGTGGCACATATGGACCATGG + Intergenic
1173271542 20:41540641-41540663 AAGGAAGCACAGCTGGATGAAGG - Intronic
1173556284 20:43968341-43968363 AAGGTGGCACAGATGGACCTGGG + Intronic
1175372196 20:58499583-58499605 AAGGAGCCACAGCTTGTCCAAGG - Intronic
1175722293 20:61294533-61294555 AAGGCTGCAGAACTGGCCCACGG + Intronic
1175964179 20:62652141-62652163 AAGGAGCCTCAACAGGGCCAAGG - Intronic
1176157478 20:63628916-63628938 AAGGAGGCAGAACAGGCCCCAGG - Intergenic
1177189735 21:17837574-17837596 TATAAGGCACAACTGGGCCAGGG + Intergenic
1179054925 21:37922463-37922485 AAGGAGGAAGAACTGGTTCAAGG + Intergenic
1180052578 21:45338401-45338423 AGGTAGCCACAACTTGACCATGG + Intergenic
1181914450 22:26268398-26268420 AAGGAGGGGCAACATGACCAAGG + Intronic
1182518335 22:30871464-30871486 AGGGCGGCACATCTGGGCCAGGG + Intronic
1183300572 22:37057086-37057108 AAGGAGACAGAACCGGAACACGG - Intronic
1183604284 22:38859681-38859703 AAGGGGGCACAATTGGAGCAGGG - Intergenic
1184890804 22:47377965-47377987 AAGGTGGGACAACTGGAACCGGG - Intergenic
949459489 3:4274917-4274939 AAGGAAGCAGAACTGGACAAAGG + Intronic
949592830 3:5511333-5511355 AAGGATGCAGAACTGGACAGAGG + Intergenic
950921017 3:16694974-16694996 CAGGAGGCATAGCTGGGCCAGGG - Intergenic
951354341 3:21645743-21645765 AAAGAAGGACAACTGGACAAAGG + Intronic
953129644 3:40125631-40125653 AAGGAGGCATAAGATGACCAAGG - Intronic
953717739 3:45330354-45330376 TAGGAGGGAGAACTGGAGCAAGG - Intergenic
954827123 3:53383895-53383917 TAGGAGGCACAGCTGAGCCATGG - Intergenic
954887014 3:53883723-53883745 TAGGAGGCAGAAGAGGACCATGG + Intergenic
955224835 3:57052160-57052182 ACGGAGGCACACCTTGCCCAAGG + Intronic
956640325 3:71409514-71409536 ATGGAGACACAACTGCACTAGGG + Intronic
957149906 3:76473257-76473279 AAAGAGGCAGAACTTGAACAAGG - Intronic
959987426 3:112590640-112590662 AAGGAGTGAGATCTGGACCAAGG - Intergenic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
963600356 3:147373053-147373075 AAGGAGGCACAACTGCAGCTCGG + Intergenic
963976826 3:151489604-151489626 AATGAGGCACATATGCACCATGG + Intergenic
964313778 3:155421880-155421902 AAGGAGGCATAACCAGACCAAGG + Intronic
965263457 3:166511603-166511625 AAGGATGCAGAACTGGACAGAGG + Intergenic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
968864026 4:3196239-3196261 AGGGAGGAACAACTGGACAGAGG - Intronic
972128411 4:35800427-35800449 AAAGAGGCACACCTGCACCAGGG + Intergenic
973278763 4:48337394-48337416 AGGGAGGCACATCTGGAGGAGGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
974519851 4:62969791-62969813 AAGGAGACATAAAGGGACCATGG + Intergenic
976594978 4:86886896-86886918 AATGTGGCACAAATGCACCATGG + Exonic
977992757 4:103464748-103464770 AAGAAGGCACAGCAGGTCCAAGG + Intergenic
979237938 4:118422525-118422547 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
982289269 4:153763604-153763626 TAGGTGGCACCACTGGCCCAAGG - Intergenic
984084527 4:175292454-175292476 AATTAGTCACAGCTGGACCAGGG - Intergenic
984255232 4:177382217-177382239 AAGGAGGCAGAGCTGGGCCTGGG - Intergenic
984752839 4:183295521-183295543 ACCAAGGCACAGCTGGACCAAGG - Intronic
985717354 5:1470151-1470173 ACAGAGGCACAACTTTACCAAGG - Intronic
987011976 5:13776053-13776075 AAGGAAGCACTAATGGTCCATGG + Intronic
987819714 5:22947344-22947366 AAGGAGGGGCAACTGCACAAAGG - Intergenic
989430972 5:41355079-41355101 AAAGAGGAACAACTGGAGAAAGG - Intronic
989588355 5:43090682-43090704 CAGGAGGCACAGCTGGACTAGGG + Intronic
990204602 5:53415189-53415211 TGGGAGGGACAACTGGACAATGG - Intergenic
992542733 5:77780505-77780527 AAGGTGGGACAACTGGAAAAGGG - Intronic
996755603 5:126931950-126931972 AAGGAGGCATAACTGGTAGATGG - Intronic
996937824 5:128968119-128968141 AATGAGGCACATATGCACCATGG - Intronic
997031756 5:130138203-130138225 AAAGAGGCACAGCTGGGCTAAGG + Intronic
997362333 5:133303063-133303085 CAGGAGGCACAAAAGGACAAAGG - Intronic
998058902 5:139103797-139103819 CAGGAGGCACTTATGGACCATGG + Intronic
1001073123 5:168604146-168604168 AGGGAGGCAGAAGTAGACCAAGG + Intergenic
1001911026 5:175517877-175517899 GAGGAGGCACACCTGGCCCTGGG - Intronic
1002402638 5:178999880-178999902 AAACAGGCAAAACTGTACCACGG - Intergenic
1002738369 5:181414508-181414530 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1003415132 6:5900221-5900243 AAGGAGGCAGAACTGGGCAGAGG + Intergenic
1006932047 6:37694461-37694483 AAGGCGGCACATAGGGACCAGGG - Intronic
1007070304 6:39032252-39032274 AAGAAAGCAGAACTGGACCCTGG - Intergenic
1007484934 6:42174485-42174507 GAGGAGACACAATTTGACCACGG - Intronic
1007861142 6:44910080-44910102 AAATAGGCCCAACTGGAGCAAGG - Intronic
1007987860 6:46225140-46225162 AAGGTGGCACATATGCACCATGG - Intronic
1010382093 6:75236998-75237020 ATGGATGCACAACAGGACCCAGG + Intergenic
1011503447 6:88015508-88015530 AAGTAGGCACAAGTGGGCAAAGG - Intergenic
1012301059 6:97588318-97588340 AATGAGGGACAACTGGACATAGG - Intergenic
1017035841 6:150266476-150266498 AAGGTGGCACAGCTGGAAAATGG - Intergenic
1018841719 6:167522260-167522282 AATGAGGCTCATCTGCACCATGG - Intergenic
1019243471 6:170690060-170690082 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1021777306 7:24066650-24066672 AAGGTGGAATGACTGGACCATGG - Intergenic
1021990315 7:26135032-26135054 AGGGAGGGACAACTGGCCTAGGG + Intergenic
1022574752 7:31486718-31486740 AAGGTGGCAGAACTGGCCCTAGG - Intergenic
1023866621 7:44241489-44241511 GAGGAGCCACACCTGGCCCAGGG + Intronic
1024622809 7:51177224-51177246 CAGGAGGCACAAGTGAGCCAGGG - Intronic
1026366040 7:69649459-69649481 AAGGAGGCACAACTGGACCACGG - Intronic
1026534202 7:71226850-71226872 AAGGAGACCCAAAAGGACCACGG - Intronic
1026850772 7:73721847-73721869 AAGCCGGGACAACTGGAACAGGG - Intergenic
1027478546 7:78665505-78665527 AAGGAGCCAGAAGTGGTCCAAGG + Intronic
1028480966 7:91304088-91304110 AAGGAAGCAAAACTGGGCAAAGG - Intergenic
1030047704 7:105512404-105512426 AAGGAGACAAAAATGGACCAGGG + Intronic
1031081162 7:117258203-117258225 AAGGAGAGACAACTGGACGTGGG + Intergenic
1031380803 7:121083692-121083714 AAGAAGGTACAACTTGCCCAAGG - Intronic
1032337398 7:131038444-131038466 GAGGAAGCACAATTGGGCCAAGG - Intergenic
1032793024 7:135256357-135256379 AAGAGGGGACAACTGGTCCAGGG - Intronic
1033939178 7:146630341-146630363 AAGGTGGCACATATGCACCATGG - Intronic
1035504651 8:118098-118120 AAAAAGGCAAAACTGGGCCAGGG - Intergenic
1035667913 8:1392489-1392511 AATGAGGCACAGCAGGACAATGG - Intergenic
1035840174 8:2803047-2803069 AACGATGTACAAATGGACCACGG - Intergenic
1035959883 8:4125379-4125401 AAGGTGGGACAACTGGAGCAGGG - Intronic
1037519235 8:19663576-19663598 AAGGAGGTACCACTGTACCCAGG - Intronic
1038244379 8:25841137-25841159 AGGGAGGCAGGGCTGGACCAGGG - Intergenic
1040802859 8:51363090-51363112 CAGGAGGCAAAACTGGGCCAGGG - Intronic
1041747470 8:61224186-61224208 AAGGGGGCAGAACTGGACGGAGG - Intronic
1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG + Intronic
1047607952 8:126493295-126493317 AAGTAGGCACACCTGGATCCAGG - Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1048458448 8:134599729-134599751 AAGGAAGCACATCTGGCCCCAGG - Intronic
1050085920 9:1965616-1965638 AACGGGACACAACTGGCCCAAGG + Intergenic
1050774219 9:9239759-9239781 CAGGAGTCACAACTGGGCCAGGG - Intronic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1052589493 9:30472990-30473012 AAGAAAGCACAATTGGACAAAGG + Intergenic
1052940780 9:34130493-34130515 AAACAGGCACAACTGATCCATGG + Intergenic
1053683356 9:40499525-40499547 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1053933336 9:43127840-43127862 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054280358 9:63125403-63125425 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1054296460 9:63335023-63335045 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054394477 9:64639528-64639550 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054429126 9:65144727-65144749 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054501257 9:65876808-65876830 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1059505585 9:114796745-114796767 AAGGAGGCTCAACAGGACATGGG + Intronic
1061800778 9:133112505-133112527 AGAGAGGAACAACTGGTCCAAGG + Intronic
1062052102 9:134452913-134452935 GAGGAGGCAGCACTGGAGCAGGG + Intergenic
1203603660 Un_KI270748v1:39283-39305 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1186247143 X:7626339-7626361 AAGGAGGCACATCTGAGCAAAGG - Intergenic
1186368973 X:8927215-8927237 AGGGAGGCCCAACTGAAACAGGG - Intergenic
1186989846 X:15055602-15055624 AAGGAGGCACAATGGGAGCTAGG - Intergenic
1187422865 X:19151424-19151446 AAGGGAGCAAAACTGGACTAGGG - Intergenic
1188284797 X:28314491-28314513 CAGGAGGCAGAGCTAGACCAGGG - Intergenic
1188309247 X:28597064-28597086 AAGGAGGACCAAATGGAGCATGG + Intronic
1189233331 X:39469271-39469293 AAGGTGGCTCTGCTGGACCAAGG + Intergenic
1190815006 X:53922133-53922155 AAGGCGGCACAACTGGACCAGGG - Intergenic
1191985064 X:66970698-66970720 AATGAGGCACATATGCACCATGG - Intergenic
1194446057 X:93987882-93987904 AAGGGGGCAGAACTGGACAAAGG + Intergenic
1195983348 X:110602957-110602979 AAGGTGGCACATATGCACCATGG - Intergenic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1197046347 X:122003349-122003371 AAGGACGCAGAACTGGACAGAGG - Intergenic
1197728654 X:129792870-129792892 AGGGAGGCACAACTGCCCCAGGG + Intronic
1198664000 X:139001972-139001994 AATGTGGCACAAATGCACCAAGG + Intronic
1199442193 X:147881013-147881035 CAGGAGGCAGAGCTGGGCCAGGG - Intergenic
1199546064 X:149008343-149008365 AACTAGGCACAACTGACCCAAGG - Intergenic
1199592094 X:149476880-149476902 AAGGGGGCACACCTGTACCACGG + Intergenic
1200888239 Y:8294066-8294088 AAGGAGAATCACCTGGACCAGGG + Intergenic
1201979798 Y:19893990-19894012 AAGGATGCAGAACTGGACAGAGG + Intergenic
1202385725 Y:24324326-24324348 AAAAAGGCAAAACTGGGCCAGGG + Intergenic
1202485061 Y:25345802-25345824 AAAAAGGCAAAACTGGGCCAGGG - Intergenic