ID: 1026371122

View in Genome Browser
Species Human (GRCh38)
Location 7:69700536-69700558
Sequence GAAAATCCCCAGAGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026371122_1026371127 -1 Left 1026371122 7:69700536-69700558 CCTGGCTGCCTCTGGGGATTTTC 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1026371127 7:69700558-69700580 CCATATGGAGTGACAGACTTGGG No data
1026371122_1026371125 -2 Left 1026371122 7:69700536-69700558 CCTGGCTGCCTCTGGGGATTTTC 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1026371125 7:69700557-69700579 TCCATATGGAGTGACAGACTTGG 0: 1
1: 1
2: 0
3: 14
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026371122 Original CRISPR GAAAATCCCCAGAGGCAGCC AGG (reversed) Intronic
900784011 1:4636393-4636415 GCAGATGCCCAGAGGCTGCCTGG - Intergenic
901676744 1:10889778-10889800 GAAACTCCACACAGGCAACCTGG + Intergenic
902193358 1:14779340-14779362 GAAAAGCCCCAGAGGGAAGCCGG - Intronic
903055713 1:20634630-20634652 GCCAATCCCCATAGGGAGCCAGG - Intronic
903231177 1:21923109-21923131 GAAAATAACCAGACTCAGCCGGG + Intronic
903511162 1:23875844-23875866 GTACCTCCCCTGAGGCAGCCAGG - Intronic
904822618 1:33255862-33255884 GGAGACCCCCAGGGGCAGCCTGG + Intergenic
906214792 1:44032238-44032260 ACCACTCCCCAGAGGCAGCCTGG - Intergenic
906275070 1:44509253-44509275 GAAAATAGGCATAGGCAGCCGGG + Intronic
906801016 1:48736986-48737008 AAAAATCACCAGTGACAGCCAGG + Intronic
907199448 1:52713867-52713889 GAAAATGTCTAGAGCCAGCCTGG + Intergenic
908834172 1:68211882-68211904 AAAATTTCCCAGATGCAGCCAGG - Intronic
908877149 1:68690551-68690573 GAACTTACCCAGAGGTAGCCAGG + Intergenic
914800144 1:150955461-150955483 GCAAGTCTCCAGAGGCAGGCTGG - Intronic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
919513421 1:198494074-198494096 ACAAATCCCCAGACTCAGCCAGG - Intergenic
920260464 1:204685026-204685048 GAGAATGCCCAGAAGCGGCCAGG - Intronic
920943200 1:210503358-210503380 GTAAGTCCCCAAAGGAAGCCAGG + Intronic
921957298 1:220998024-220998046 GGAACTCTCCAGAGGCAGGCTGG - Intergenic
922178753 1:223217187-223217209 AAAAATCCCCAGAGGCCTCCTGG - Intergenic
922672403 1:227520810-227520832 CAAAATCTCCAGAGGCATCTTGG - Intergenic
922982519 1:229839725-229839747 GAAAAGCCCCAGAGTAAGACGGG - Intergenic
923009541 1:230077192-230077214 GGAAAGCCCCAGAGGCAGCAAGG - Intronic
923954709 1:239002957-239002979 GATAATACACATAGGCAGCCAGG + Intergenic
923959364 1:239059278-239059300 GACAATCCCTAGAGGCAGCCAGG - Intergenic
924759794 1:246972811-246972833 TAAAAAACCCAGAGGCTGCCGGG - Intronic
1064081209 10:12309300-12309322 GTAACTCTCCAGAGACAGCCGGG + Intergenic
1064951339 10:20854422-20854444 AATAGTCCCCAGAGGGAGCCTGG + Intronic
1065901127 10:30209086-30209108 GAAAATCAACAGAGGAAGCATGG - Intergenic
1066055615 10:31677813-31677835 AAAAGTCCCCATAGGCACCCTGG - Intergenic
1066388831 10:34962704-34962726 CAAAATGCCCACAGGCAGGCTGG - Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067150988 10:43733711-43733733 GAAAATTACCAGAGGCAGAGAGG + Intergenic
1068303729 10:55177513-55177535 GCAACTGCCCAGAGGCAGGCCGG - Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069899283 10:71697695-71697717 GACACTCCCCAAAGGCAGGCAGG - Intronic
1069932232 10:71890578-71890600 GAAATTCTCCAGGGGCAGACTGG + Intergenic
1070062600 10:72999071-72999093 GAAAATAAGCAAAGGCAGCCTGG - Intergenic
1072581794 10:96746231-96746253 GAAAATTCCCAAAGGCAGTTTGG - Intergenic
1073530922 10:104231781-104231803 GAAAATCACCAAAGGTAGCAAGG + Intronic
1075028966 10:119008251-119008273 GAATACCGCCAAAGGCAGCCAGG - Intergenic
1075559942 10:123460895-123460917 GTAAATCCCAGGAGCCAGCCTGG + Intergenic
1076384076 10:130044772-130044794 GTACATCCCCAGAGGAAGTCTGG - Intergenic
1076750461 10:132539537-132539559 GGAGCTCCCCAGAGGCAGGCCGG + Intronic
1078614669 11:12854089-12854111 GAAAATCACCAGAAACAGCCAGG - Intronic
1080682584 11:34490297-34490319 GAAAATCTGCAGAGGCTGCTGGG - Intronic
1082723363 11:56706091-56706113 GACATTCCCCAGAACCAGCCTGG + Intergenic
1083191715 11:61057029-61057051 GAACAGCCCCAAAGGAAGCCAGG + Intergenic
1084027650 11:66462349-66462371 GAAAATTCCCAGCCTCAGCCAGG + Intronic
1085520776 11:77137861-77137883 CTCACTCCCCAGAGGCAGCCAGG + Intronic
1085525594 11:77161763-77161785 GAAAGACCCCAGAGGCTGGCTGG - Intronic
1093089189 12:14902685-14902707 GATCATCCCCAGAGCCAGACTGG + Intronic
1094501370 12:31023695-31023717 GACAACCCCCAGTGCCAGCCCGG + Intergenic
1095436702 12:42196620-42196642 GAAAAACCCAAGAGGCAACAAGG + Intronic
1095466205 12:42490379-42490401 GAGACTGCCCAAAGGCAGCCAGG + Intronic
1095786159 12:46110659-46110681 GAAATTCCCCAGTACCAGCCTGG + Intergenic
1095909561 12:47412276-47412298 GCCAATGCCCAGAGACAGCCTGG - Intergenic
1096357439 12:50953036-50953058 GAAACTCACCAGTAGCAGCCTGG - Intergenic
1097281019 12:57845710-57845732 GAAACTGGTCAGAGGCAGCCGGG + Intronic
1097925781 12:65124767-65124789 GAAAATCCTTCGAGGCAGACTGG + Intergenic
1100526313 12:95423050-95423072 TAAAAAACCTAGAGGCAGCCAGG + Intergenic
1100591161 12:96030767-96030789 GAAAGTACCCAGGGGCAGCTGGG - Intronic
1101315728 12:103627210-103627232 GACACTCACCAGAGGCAGACTGG - Intronic
1102200163 12:111052326-111052348 GACAATCCACAGAGGGAGGCCGG - Intronic
1102535199 12:113575972-113575994 CCAACTCCCCAGGGGCAGCCTGG + Intergenic
1102847518 12:116202740-116202762 GAAGAACCCCAGAGGCTGTCAGG - Intronic
1103968424 12:124654702-124654724 GAAAATCCCCTGAGGCTCACTGG + Intergenic
1104750350 12:131234491-131234513 GAAAATCGCCAAAGCCAGGCTGG - Intergenic
1104782371 12:131429971-131429993 GAAAATCGCCAAAGCCAGGCTGG + Intergenic
1105990362 13:25614808-25614830 GACATTCCCCAGTGGCAGCCTGG - Intronic
1106098386 13:26670841-26670863 GAATAGCCCCATAGGCACCCAGG + Intronic
1106251762 13:27987275-27987297 GGACAGCCCCTGAGGCAGCCTGG + Intronic
1108169344 13:47725231-47725253 GAAGAACACCAGAGGTAGCCAGG + Intergenic
1108464950 13:50706138-50706160 GAAAATACCCTGAGGTAGCATGG - Intronic
1109163418 13:59003977-59003999 AGAAATCCAGAGAGGCAGCCTGG + Intergenic
1109345895 13:61113974-61113996 TAAAAACCCCAGACCCAGCCAGG + Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1114178959 14:20349041-20349063 GAAAATACCTTAAGGCAGCCAGG + Intronic
1114430245 14:22654599-22654621 GCAGATCCCCAGAAGCAGCAGGG + Intergenic
1118396579 14:65342240-65342262 GATAAACCTCAGAGACAGCCAGG + Intergenic
1119483507 14:74974256-74974278 GACAGTCCCCAAAGGCTGCCTGG - Intergenic
1119767767 14:77201156-77201178 GAGAATCCACAAAGGCTGCCTGG - Intronic
1121476166 14:94206217-94206239 GAAAATCACCAGAGACAGACAGG - Intronic
1121576772 14:94995327-94995349 GAAACTCCTCTGAGGCAGACAGG - Intergenic
1121908348 14:97767558-97767580 GAAAACCCCAAGACCCAGCCGGG - Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1123940385 15:25213872-25213894 GAAAGCCCACAGAGGGAGCCTGG - Intergenic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1125479319 15:40069575-40069597 GAGCAGCCTCAGAGGCAGCCTGG - Intergenic
1127282874 15:57506603-57506625 AAAATTCCCCAGAGCCAGCCAGG - Intronic
1127474431 15:59319606-59319628 AAAAAACCCCAGAGACAGCCAGG + Intronic
1128665297 15:69533186-69533208 GAAAATCCGGAGAGGTAGCTTGG + Intergenic
1129482728 15:75840899-75840921 GAAAATATCCAGAGGCAGAAAGG - Intergenic
1129570808 15:76682063-76682085 GAAGAGCCCCAGCGGCACCCTGG - Intronic
1130611654 15:85366879-85366901 GAAGATCCCTAGACTCAGCCGGG + Intergenic
1131436816 15:92429573-92429595 GAAATTCAACAGAGGCAGCAAGG - Intronic
1131489346 15:92849144-92849166 GCAAACCACCAGAGGCAGCCAGG + Intergenic
1131582815 15:93661898-93661920 GAAAATCTCCTGAGGCTGCAGGG + Intergenic
1133810305 16:9156276-9156298 AAAAATCCCCAGGGGCAGAGTGG - Intergenic
1137367915 16:47876766-47876788 GAAAAACCCCAAAAGCACCCGGG + Intergenic
1139949974 16:70663959-70663981 GCCCATCCCCAGAGGCAGCCGGG - Exonic
1141101736 16:81202532-81202554 GAGGATCCCCAAAGACAGCCTGG + Intergenic
1142167096 16:88597952-88597974 GCAGTTCCCCAGAGGCTGCCAGG - Intronic
1143281008 17:5754033-5754055 GAAAATCCACTGTGGCAGCCAGG - Intergenic
1143541338 17:7571261-7571283 GAACATCCCCAAAGGGAGCCAGG - Intronic
1144217953 17:13073183-13073205 GAAAGTCCCTAGATGCAGTCAGG - Intergenic
1144631121 17:16873059-16873081 GAAAATGTCCAGAGACTGCCGGG - Intergenic
1145058093 17:19716236-19716258 GACAATCCCCAGTGGCAGTGGGG - Intronic
1145713523 17:26997258-26997280 GAAAGTCCCAAGAGACAGGCAGG - Intergenic
1145905450 17:28513853-28513875 GAAGGTGCCCAGAGGCAGCCAGG + Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1148629190 17:49093370-49093392 GAAAAGCCCCAGAGGCGGAGGGG - Intergenic
1150244608 17:63665005-63665027 CAAAATCTCCACAGGCAGCTGGG + Intronic
1151568613 17:74914936-74914958 GAACATCCCCACAGGCTCCCTGG + Intergenic
1152070177 17:78130473-78130495 GGACATCCCTGGAGGCAGCCAGG + Intronic
1152076926 17:78165504-78165526 TAAAACTCCCAGAGGCAGGCCGG + Intronic
1152242953 17:79169654-79169676 GCAAATCCACAGAGGCTGGCAGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152494427 17:80660964-80660986 GAAAACCCCCAAGGGCAGCTGGG - Intronic
1153965869 18:10181751-10181773 GAAAACCCCCAGTACCAGCCTGG - Intergenic
1154333459 18:13448456-13448478 AAAAATCCCCAGCGCCTGCCTGG + Intronic
1155179387 18:23330943-23330965 GAAAAGGCCCACGGGCAGCCTGG + Intronic
1155252396 18:23964953-23964975 GTAAAACCAAAGAGGCAGCCTGG + Intergenic
1155347946 18:24877248-24877270 GAACATCCCCACATGCTGCCTGG + Intergenic
1157448584 18:47767738-47767760 CAAAATCCACAGAGGCACCCTGG + Intergenic
1158136068 18:54209635-54209657 TAAAATCCCCTGGGGCAGCCAGG - Intronic
1158301524 18:56058057-56058079 GAAGTTCCCCAGAGGAGGCCGGG - Intergenic
1158481274 18:57823884-57823906 GAGGACCCCCAGAGGCTGCCTGG + Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1159580997 18:70234697-70234719 GAAAATATCCAGAGGCAGGATGG - Intergenic
1160700846 19:506650-506672 GAAGATCCACAGAGGTCGCCTGG + Intergenic
1160720163 19:593709-593731 GAAAGTCCCCAGAGGCATGCTGG + Intronic
1161349704 19:3784991-3785013 GAGCCTCCCCAGAGGCATCCTGG + Intronic
1161430031 19:4226108-4226130 GGAAACCCCCAGGGGCAGGCTGG - Intergenic
1161670904 19:5608707-5608729 GCCACTCCCCAGAGGCACCCAGG + Intronic
1163668964 19:18616685-18616707 TTAAAACCCCAGAGGGAGCCGGG - Intronic
1163859989 19:19737836-19737858 GAGACTCTCCACAGGCAGCCAGG - Intergenic
1164607991 19:29613672-29613694 GCAAAGCCCCAGGGGAAGCCTGG + Intronic
1165902734 19:39176337-39176359 CAAAAGCCCCAGAGGCTGTCAGG + Intronic
1166073647 19:40401075-40401097 AAAAATCCCCAGATCCATCCTGG + Intronic
1166296040 19:41890012-41890034 CAAAATGCCCAGAGGCCGCCGGG - Intronic
1166334631 19:42098115-42098137 GAAAACCTACATAGGCAGCCAGG + Intronic
1166676615 19:44745266-44745288 GAAACTTCCCAGAGGAGGCCAGG - Intergenic
1167622154 19:50566463-50566485 GAAAGTCACCAGAGGCTGCGGGG + Intronic
1167714883 19:51136869-51136891 AAAACTCCCCAGAGTCACCCCGG - Intergenic
1168118380 19:54238959-54238981 GAAACCCCCAAGATGCAGCCGGG - Exonic
1168210161 19:54884334-54884356 CAAAAACCCCAGTTGCAGCCAGG + Intronic
1202681766 1_KI270712v1_random:11817-11839 GAAACTCCCTTGATGCAGCCAGG - Intergenic
925343735 2:3154870-3154892 GCAAATCACCTAAGGCAGCCGGG - Intergenic
926014148 2:9434464-9434486 GATCCTGCCCAGAGGCAGCCTGG - Intronic
926652742 2:15364235-15364257 GAAAATGCCTTGAAGCAGCCGGG + Intronic
926882914 2:17568355-17568377 GAAAATCACCAGAGGCTGGAAGG - Intronic
927155122 2:20216896-20216918 GAAGATCCACAGAGAGAGCCAGG + Intronic
930439917 2:51391941-51391963 GAGAATCTAGAGAGGCAGCCTGG - Intergenic
930669128 2:54129426-54129448 CAAAATCCCTAAAGTCAGCCAGG - Intronic
930723809 2:54663595-54663617 GAGAAAGCCCAGAGACAGCCAGG - Intronic
931821489 2:65956599-65956621 GCAAAGCCCAAGTGGCAGCCAGG - Intergenic
931848378 2:66228422-66228444 GAACACCTCCAGAGGCAGGCTGG - Intergenic
932613933 2:73220089-73220111 GAGAATGCCCAGAGGCTGACCGG + Exonic
932948462 2:76265143-76265165 GCAAAGCCGCAGAGGCAGCCAGG + Intergenic
933495750 2:83048287-83048309 GAAAATCCTCAGAGAAAGACTGG + Intergenic
933722524 2:85407415-85407437 GAAAAACCCCAGTGCCAGCCAGG + Intronic
937529344 2:122809196-122809218 GACAACCCCCAGTGCCAGCCCGG + Intergenic
937542838 2:122980730-122980752 GAAAGTCCCCTGAGGCAACAGGG + Intergenic
937671259 2:124539636-124539658 CAAAATTCCAAGAGGCAGGCGGG - Intronic
937672206 2:124550072-124550094 TAAAGTCCCCAGAGTTAGCCTGG + Intronic
939548044 2:143577842-143577864 GATACTCCCCAGAGGAAACCTGG + Intronic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
945243975 2:207701234-207701256 CAAAATCTCAAGAGCCAGCCAGG - Intergenic
946074846 2:217065211-217065233 CAAAATACCCACAGGGAGCCAGG + Intergenic
946280926 2:218664940-218664962 GCAGATCTCCTGAGGCAGCCTGG - Intronic
946414014 2:219530300-219530322 CTAAATCCCCAGCGGGAGCCTGG + Intronic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
947533052 2:230924841-230924863 AAACCTCCCCATAGGCAGCCTGG - Intronic
947570315 2:231228522-231228544 GAATGTCCCCAGAGAGAGCCAGG + Intronic
948535405 2:238642808-238642830 GAAAATACTAAGAGGCATCCTGG + Intergenic
948576791 2:238956977-238956999 GACACTCCCCAGAACCAGCCAGG + Intergenic
948860191 2:240749210-240749232 TAAAATCACCCAAGGCAGCCAGG + Intronic
1170714175 20:18817695-18817717 GAAAGTCCCTAGAGGCAGTGGGG - Intronic
1170894039 20:20398370-20398392 GTGCATCCCCAGACGCAGCCTGG + Intronic
1170894466 20:20401302-20401324 AAAAATCCCCTGGGGCACCCAGG + Intronic
1172293464 20:33791871-33791893 GAGGCTACCCAGAGGCAGCCTGG - Exonic
1174191193 20:48741935-48741957 TAAAATCCCCACAGCCCGCCAGG - Intronic
1174380903 20:50154801-50154823 GAAATTCCATACAGGCAGCCGGG + Intergenic
1177262614 21:18750124-18750146 AAAAATCCCCAGACTTAGCCAGG + Intergenic
1177726092 21:24970319-24970341 GAAAAACCTAAGAGGCATCCTGG + Intergenic
1178959103 21:37047697-37047719 GACAACCCCCAGTGCCAGCCTGG + Intergenic
1179434987 21:41355632-41355654 GAAAATCCACAGAGTCAGAAAGG + Intronic
1179820320 21:43933497-43933519 GAAAATGTCAAGAAGCAGCCAGG - Intronic
1181174747 22:21029123-21029145 GGTATTCCCCAGGGGCAGCCTGG - Exonic
1181890000 22:26054097-26054119 TAGAAACCCCAGAGGCATCCAGG - Intergenic
1182774709 22:32822249-32822271 GAACATACCCAGAGACAGCGAGG - Intronic
1182994853 22:34802662-34802684 GAAAATACCCAAAGACGGCCGGG + Intergenic
1183172569 22:36198903-36198925 GAAACACCCCAGGGTCAGCCAGG + Intronic
1183474200 22:38026881-38026903 GAGGAGCCTCAGAGGCAGCCGGG - Intronic
1184301182 22:43562029-43562051 AAAAGTCACCAGAAGCAGCCAGG - Intronic
1184445761 22:44545900-44545922 GAAAATGCCCCCAGGGAGCCTGG + Intergenic
949671960 3:6409009-6409031 AAAAATCACCAGAGGTATCCAGG + Intergenic
950443517 3:13023255-13023277 GAAATGCCCCAGACCCAGCCTGG - Intronic
950520065 3:13492837-13492859 TAAAATCCCCACACCCAGCCAGG - Intronic
952811905 3:37411681-37411703 AAAAATCACCAGTGGCAGCCAGG - Intronic
953267327 3:41404340-41404362 GAAAATTACCAGAGGCAGAGAGG - Intronic
953443063 3:42936425-42936447 GAAAAGCTGCAGAGGCCGCCAGG + Intronic
953682244 3:45048393-45048415 GTCACTGCCCAGAGGCAGCCGGG - Intergenic
955171332 3:56568115-56568137 GAGAATCCTCAGAGAAAGCCTGG + Intronic
955461552 3:59189312-59189334 GACAATCCCCAGTACCAGCCTGG - Intergenic
955600065 3:60635630-60635652 GAAAATACTAAGAGTCAGCCAGG - Intronic
956339146 3:68201915-68201937 GCAAAACCCAAGAGGCATCCTGG + Intronic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
958490436 3:94765949-94765971 GACAATCCCCAGTACCAGCCTGG - Intergenic
960810493 3:121623150-121623172 CAAAATCTCCAGGGGCAGGCTGG - Exonic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
962218079 3:133540102-133540124 CAAAATCCCCAGAGGCAGAGGGG - Intergenic
962764622 3:138549898-138549920 GATAATCCCCAGTACCAGCCTGG + Intronic
963373816 3:144437699-144437721 GACATTCCCCAGTAGCAGCCTGG - Intergenic
964720301 3:159763622-159763644 GAGCATGCCCAGAGGCTGCCGGG - Intronic
966553344 3:181230137-181230159 GACATTCCCCAGCAGCAGCCTGG - Intergenic
967994037 3:195153353-195153375 GCAATTCCCCAGAGCCAGCGGGG + Intronic
974645369 4:64683576-64683598 GAAATGGCCCAGAGGCTGCCGGG + Intergenic
974884263 4:67797284-67797306 GAAAATCACCAGAGACAGAGAGG - Intergenic
975321342 4:73012224-73012246 TAAAAACCCCAGACTCAGCCAGG + Intergenic
975671039 4:76781017-76781039 GAAATTCCTCAGAGGAATCCAGG + Exonic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
978953904 4:114593202-114593224 GAAAGTTCCTAGAGGCAGCAGGG - Intergenic
980926775 4:139145379-139145401 GACATTCCCCAGAATCAGCCTGG + Intronic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
984169423 4:176343182-176343204 TAAAACCCCCAGACTCAGCCAGG - Intergenic
984935829 4:184888772-184888794 GATGCACCCCAGAGGCAGCCAGG + Intergenic
985774075 5:1831627-1831649 GGAGATCCCCAGAGGGGGCCTGG + Intergenic
986300423 5:6474366-6474388 AAAAATTCCCAGAGCCAGCAGGG + Intronic
994583409 5:101676333-101676355 AAAAATACCCAGAGCCATCCAGG - Intergenic
994754938 5:103782273-103782295 GAAAATCCCTAAAGGCAGAGTGG + Intergenic
994774892 5:104028491-104028513 GCAACTCCTCAGAGGCAGACTGG - Intergenic
995417021 5:111923649-111923671 GCAACTGCCCAGAGGCAGGCTGG + Intronic
996039279 5:118792540-118792562 TCACATCCCCAGAGACAGCCAGG + Intergenic
997047418 5:130334940-130334962 GAAAAGACCCAGACACAGCCTGG - Intergenic
997581432 5:135019816-135019838 GGAAATCCCAAGAGGTAGGCAGG + Intergenic
998105772 5:139468267-139468289 TAAAAACCACTGAGGCAGCCGGG - Intergenic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
998471969 5:142390490-142390512 GTAAAACCCCAGGGGCAGCAGGG - Intergenic
999245957 5:150154911-150154933 TTAAATCCCCAGAGGTTGCCTGG + Intronic
1000757849 5:165183787-165183809 GACAATCCCCAGTACCAGCCTGG - Intergenic
1001266725 5:170279209-170279231 GAACCTCCCCACAGGAAGCCAGG + Intronic
1002026923 5:176402005-176402027 TAAAATATCCAAAGGCAGCCGGG + Intronic
1002672172 5:180876566-180876588 GAAAAACCTCAGAGGCAGAGAGG - Intergenic
1003972088 6:11309469-11309491 GAGAATCCCTTGAGGCAGCCTGG - Intronic
1006058699 6:31404006-31404028 GAGCAGCCCCGGAGGCAGCCCGG - Intronic
1006133581 6:31882826-31882848 GAAAAGCCCCAGGGGCAGGGAGG + Intronic
1006365032 6:33610269-33610291 GAAAAGGCCCAGAGGCAGGAAGG - Intergenic
1006740596 6:36305668-36305690 GAAAATCCCCTGAAGGGGCCTGG - Intronic
1010181827 6:73095728-73095750 GACAATCCCCAGTGCCAGCCCGG - Intronic
1010276995 6:73980144-73980166 GAAACTCCTCAGAGGCAGTAGGG + Intergenic
1012831544 6:104209858-104209880 TAGAATCCCTAGAGGAAGCCTGG + Intergenic
1015005184 6:128271589-128271611 GCAAATCCCTACTGGCAGCCTGG + Intronic
1015067914 6:129053358-129053380 GAAATTCACCAGAGTCGGCCGGG - Intronic
1016868374 6:148792031-148792053 TAAAATCCTCAGAGGAAGCGGGG + Intronic
1018863228 6:167727352-167727374 GAAAGGCCCCAGAGCCACCCTGG - Intergenic
1018926317 6:168209414-168209436 CCAAATCTTCAGAGGCAGCCTGG + Intergenic
1019043110 6:169122326-169122348 GAAACCACCCAGAGGCAGGCTGG - Intergenic
1019563621 7:1669492-1669514 GCAGAGCCCCAGGGGCAGCCTGG - Intergenic
1020018124 7:4843566-4843588 CAAAATGCCCAGAGTCAGGCTGG - Intronic
1021272402 7:18605973-18605995 TAAAAACTCCAGGGGCAGCCAGG - Intronic
1023481389 7:40638629-40638651 GCAAATCCCCAAAGGCAGAAAGG - Intronic
1024984117 7:55181063-55181085 GGGAATCCCCAGATGCACCCAGG + Intronic
1025000236 7:55309832-55309854 GAAAATCCCCAGCTGCACTCTGG + Intergenic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1028529577 7:91824232-91824254 GACACTCCCCAGTAGCAGCCTGG - Intronic
1029382991 7:100225482-100225504 GAAGAGCCCCAAATGCAGCCTGG - Intronic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1032325277 7:130922222-130922244 GAAAACGCTCAGAGGCTGCCAGG + Intergenic
1033028801 7:137804986-137805008 GAGAAACCCCAGAAGCAGCTGGG + Intronic
1034967224 7:155398863-155398885 CGAAATCTCCAGAAGCAGCCAGG + Intergenic
1035758659 8:2053086-2053108 GAAAATTCCCAGAAGTAGCAGGG - Intronic
1037718036 8:21416278-21416300 GAAAATCCCTGGGGGCATCCAGG - Intergenic
1038256847 8:25958102-25958124 TAAACTCTCCAGAGGCATCCCGG + Intronic
1039182305 8:34880401-34880423 GAAAATCCCAGGACTCAGCCAGG - Intergenic
1040119047 8:43660486-43660508 GAATATCCCCAGAGGAAAACTGG + Intergenic
1044224532 8:89704146-89704168 GACATTCCCCAGAACCAGCCTGG - Intergenic
1045414035 8:101948779-101948801 GGACTTCCCCATAGGCAGCCTGG - Intronic
1048545389 8:135381992-135382014 GAAAATGCTCAGAGGCATTCTGG - Intergenic
1048784210 8:138033416-138033438 GAAAATTCCCAAATGCAACCGGG + Intergenic
1049021763 8:139961830-139961852 TAAAAGCCCCAGACTCAGCCAGG + Intronic
1049404847 8:142447750-142447772 GGGGATCCTCAGAGGCAGCCCGG + Intergenic
1050253540 9:3770835-3770857 TAAAATACCACGAGGCAGCCAGG + Intergenic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1050575649 9:6992460-6992482 AAAAATCCCCAGAGGTCACCAGG - Intronic
1050743108 9:8845413-8845435 GAATATCGCCAGAGCTAGCCAGG - Intronic
1051613099 9:18980633-18980655 GAAAATCCCAGAAGGCAGGCAGG - Intronic
1052697175 9:31892526-31892548 AGAAATCCCCAGCGGCAGCATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053390675 9:37733279-37733301 AAAAATCCCCACAGGCATTCAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056370157 9:85945813-85945835 AAAAATCACCAGAGTCAGGCTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058871090 9:109202230-109202252 GAAAAGCCCTGGAGGCAGCTGGG + Intronic
1059466546 9:114472285-114472307 GAAAGTCCCCAGACTCGGCCTGG + Intronic
1061285829 9:129621935-129621957 GAAGCGGCCCAGAGGCAGCCGGG - Intronic
1061886731 9:133594858-133594880 GCAAAGGCCCAGAGGCAGGCAGG + Intergenic
1061954288 9:133953568-133953590 CAAAGTCCCCAGAGGGACCCTGG + Intronic
1062214629 9:135382571-135382593 CCAAATCACAAGAGGCAGCCTGG + Intergenic
1186435838 X:9542674-9542696 GAAACTCCCCAGAGGGAAACTGG + Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187773542 X:22730147-22730169 GACAATCCCCAGTACCAGCCTGG - Intergenic
1187828519 X:23357102-23357124 GAAGAGCCCCAGAGGCAGCCTGG - Intronic
1188957691 X:36453526-36453548 GAAAAGCCCCACAGAAAGCCAGG + Intergenic
1191102316 X:56744724-56744746 CAAAATCCCCAGTGGATGCCTGG + Intergenic
1192068493 X:67911824-67911846 GAAAATTCCAATATGCAGCCAGG + Intergenic
1192563793 X:72145823-72145845 GAAAACCTCCAGAGGTAGCAAGG - Intergenic
1192848711 X:74931213-74931235 GAGAAGCCCCAGATGAAGCCAGG + Intergenic
1193078027 X:77375730-77375752 GACAATCCCCAGTACCAGCCCGG + Intergenic
1193779592 X:85685871-85685893 GACAATCCCCAGTACCAGCCTGG - Intergenic
1193995765 X:88364799-88364821 GACATTCCCCAGAAGCAGCCTGG + Intergenic
1194123740 X:89989852-89989874 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1195838207 X:109143531-109143553 GAAACTCCCCAGTACCAGCCTGG + Intergenic
1197978040 X:132186142-132186164 GGAAATCCACAGGGACAGCCAGG + Intergenic
1198792609 X:140362076-140362098 GAAAATCCGTAGAGGCAGAAAGG + Intergenic
1199057787 X:143318697-143318719 GACAACCCCCAGTGCCAGCCCGG - Intergenic
1199521446 X:148740954-148740976 GACAATCCCCAGTACCAGCCTGG - Intronic
1200476626 Y:3647473-3647495 GCAACTGCCCAGAGGCAGGCTGG + Intergenic