ID: 1026373246

View in Genome Browser
Species Human (GRCh38)
Location 7:69723144-69723166
Sequence CTGGCTGCTGTGAATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026373246_1026373253 28 Left 1026373246 7:69723144-69723166 CCTTCATCATTCACAGCAGCCAG 0: 1
1: 0
2: 3
3: 30
4: 352
Right 1026373253 7:69723195-69723217 CATTTGGAGTAGCAGAATCGTGG 0: 1
1: 0
2: 0
3: 2
4: 82
1026373246_1026373251 12 Left 1026373246 7:69723144-69723166 CCTTCATCATTCACAGCAGCCAG 0: 1
1: 0
2: 3
3: 30
4: 352
Right 1026373251 7:69723179-69723201 CCACTTTAGCCTTGATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026373246 Original CRISPR CTGGCTGCTGTGAATGATGA AGG (reversed) Intronic
900157040 1:1207268-1207290 CTGTCTGGTGTGACGGATGAAGG - Intergenic
900320243 1:2079951-2079973 CTGGCTGCTTTGGGTGAGGAAGG + Intronic
900351546 1:2237343-2237365 CTGGCTGCTGTGGTTCCTGAAGG + Intronic
900624151 1:3600522-3600544 CTGGCTCCTGGGAGGGATGAAGG + Intronic
901310711 1:8267503-8267525 CTGGATGCTGGCAATGGTGATGG + Intergenic
902390018 1:16098049-16098071 AAGGCTGCAGTGAATTATGATGG + Intergenic
902649459 1:17827066-17827088 CTGGCTCCTGTGATGGATGGGGG + Intergenic
903542219 1:24102966-24102988 CTGCCTGATGTGATTGATGATGG + Intronic
904664926 1:32112890-32112912 ATGGCTGCTGAGACTGATCAGGG + Intronic
905235417 1:36542911-36542933 CTGGAGGCTGTGAGTGGTGATGG + Intergenic
905262224 1:36727947-36727969 CTGGGGGCTGTGAATGAAGATGG + Intergenic
905391965 1:37641909-37641931 CTGGCTGCTGTGGATTGTGGGGG - Intergenic
905630875 1:39517952-39517974 GTGTCTGGTGTGAATGATGCAGG - Intronic
905666885 1:39768224-39768246 GTGTCTGGTGTGAATGATGCAGG + Intronic
906058511 1:42933690-42933712 CAGGCTGCTCTGAATGAGGGTGG + Intronic
906242781 1:44252196-44252218 CTGGCTGAGGTGAAAGATGCTGG + Intronic
906928445 1:50144171-50144193 CTGGCTGGTGTGAATGTTCCAGG - Intronic
907752785 1:57279532-57279554 TTGGCTATTGTGAATGATGCTGG - Intronic
908233534 1:62129046-62129068 CTTGCTGATGTGAATTACGAAGG + Intronic
908375384 1:63532715-63532737 TTGGCTGATGTAAATGCTGATGG + Exonic
909326507 1:74357675-74357697 GTGGCTTCTGTGTAGGATGACGG - Intronic
909459329 1:75892315-75892337 CTGGCTCATGTGATTTATGAAGG - Intronic
912147704 1:106814376-106814398 CTGGCTTCTGTTAATGGAGAAGG - Intergenic
912830702 1:112950930-112950952 CAGGCTGCAGTGAACCATGATGG + Intronic
913435341 1:118841711-118841733 GTGGCTGGTGTGCATGAGGAAGG - Intergenic
913581610 1:120232816-120232838 CTGGCTCAGATGAATGATGACGG - Intergenic
913626567 1:120665572-120665594 CTGGCTCAGATGAATGATGACGG + Intergenic
914346062 1:146799450-146799472 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
914504523 1:148277263-148277285 CTAACTGCTGTGAATTATAATGG - Intergenic
914563542 1:148844263-148844285 CTGGCTCAGATGAATGATGACGG - Intronic
914609285 1:149285962-149285984 CTGGCTCAGATGAATGATGACGG + Intergenic
916055248 1:161064690-161064712 GAGGCTGCAGTGAGTGATGATGG + Intronic
917246137 1:173003368-173003390 GAGGCTGCTGTGAGTCATGATGG + Intergenic
918007269 1:180553592-180553614 CTGGCTGCTTTGGTTCATGAAGG - Intergenic
918065518 1:181098467-181098489 CTGGCTGCTGTGAAGGGAGATGG + Intergenic
918297045 1:183166874-183166896 TTGGCTGCTGTGAAGGAGAAAGG - Intergenic
918994560 1:191740166-191740188 CTGGCTCCTGTCTATGACGAGGG - Intergenic
919213207 1:194515330-194515352 CAGGCTGCAGTGAGTCATGATGG + Intergenic
922664505 1:227456979-227457001 CTGGGTGCTGGGAATAATGAAGG - Intergenic
922849102 1:228717037-228717059 CTGGCTGCTGTCCATTAGGAAGG + Intergenic
923680069 1:236111894-236111916 CTGGCTGTTTTCAATGTTGATGG - Intergenic
923835648 1:237608352-237608374 CTGGCTTTTGTTAATGAGGAGGG + Intronic
924321419 1:242854826-242854848 GCGGCTGCTGTGAAGGATGGGGG + Intergenic
924331126 1:242941475-242941497 CTTGCTGCTGTGAAGAATGAGGG + Intergenic
924761511 1:246991828-246991850 CTGGCTGTTGTGAATAGTGCTGG - Intronic
1063149889 10:3326812-3326834 ATGGCTGCTGGGAATGAAAATGG - Intergenic
1063613963 10:7586399-7586421 CTGGCTCTTAAGAATGATGAGGG - Intronic
1063933629 10:11054637-11054659 CTGACTGATGTGAAACATGAAGG + Intronic
1065166860 10:22988604-22988626 CTGAGTGCAGTGAATGATGATGG + Intronic
1067442691 10:46319028-46319050 GTGGCTGCTGTGAATGGCCAAGG + Intronic
1072999374 10:100275487-100275509 TTGGCTTCTGTGAGGGATGAGGG + Exonic
1073524892 10:104171101-104171123 CTGGATGCTGTGATAGATGTGGG - Intronic
1073577169 10:104636470-104636492 GTGCCTGCTGTGAGTGCTGATGG + Intergenic
1075531808 10:123236244-123236266 TGGGCTTCTGTGAATGAAGATGG + Intergenic
1075535211 10:123265283-123265305 CTGGGTGCTGTGAGTGGTGTGGG + Intergenic
1075624530 10:123952233-123952255 CTTCCTGCTCTGAAAGATGAGGG + Intergenic
1075741490 10:124698946-124698968 CTGGGTGGTGTGAGTGAGGAGGG - Intronic
1077368755 11:2171908-2171930 CTGCCTGCTGTGCCTGATGGAGG + Intergenic
1080224288 11:29943309-29943331 CAGGCTGCTCTGAATTATGCTGG - Intergenic
1081379324 11:42395117-42395139 CTGGCACATGTGAATGAGGACGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1081743145 11:45454947-45454969 CAGGCTGCTGTGGATGTTGTTGG + Intergenic
1083175334 11:60946364-60946386 CTGCCCGCTGTGACTGAGGATGG - Intronic
1083257410 11:61505278-61505300 CTGGCTGCTGAATAAGATGATGG - Intergenic
1083872344 11:65496858-65496880 TTGGCTCCTGTAAATGATGCAGG - Intergenic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085451763 11:76638440-76638462 CTTGCTGCTGTCAAATATGAAGG + Intergenic
1087059045 11:93960662-93960684 CTGGCTTCTGTGGATGAAGGAGG + Intergenic
1090539448 11:127684605-127684627 GTGGCTGCGGTGAAAAATGAAGG + Intergenic
1091634904 12:2189541-2189563 CTGGCTGCTGCGCGAGATGAGGG + Intronic
1092900902 12:13058474-13058496 TTGGCTGATGTGAATGGAGATGG + Exonic
1093604499 12:21073768-21073790 GTGGCTGCTGTGGGGGATGAGGG + Intronic
1095042851 12:37463069-37463091 GAGACTGCTGTGAATGATTATGG - Intergenic
1096510661 12:52126194-52126216 CTGGTTGCTCTGAAGGCTGATGG + Intergenic
1096521585 12:52187554-52187576 TTGTCTGCTGTGAATGTCGAAGG - Intronic
1096556641 12:52407977-52407999 CAGGATGGTGTGAATGTTGATGG + Intergenic
1096688283 12:53303552-53303574 CTGGCTGCCCTGAAGGTTGAGGG + Intronic
1097839948 12:64312023-64312045 CTGGATGCTGGAAATGGTGAAGG + Intronic
1098045393 12:66395290-66395312 CTGGGAGCTGTGAATGGTTAAGG + Intronic
1099219097 12:79891209-79891231 CTGGATCCTGGGGATGATGAAGG + Intronic
1100282549 12:93131738-93131760 CTGGCTCCTGGGAATGAGCAGGG + Intergenic
1100669514 12:96795455-96795477 GTGGCTGCTGTGGGAGATGATGG + Intronic
1101349931 12:103920124-103920146 CAGGCTGCAGTGAGTTATGATGG + Intergenic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1102160301 12:110763414-110763436 CAGGCTGCAGTGAACTATGATGG + Intergenic
1102680809 12:114689124-114689146 ATGGTTGCTGGGAAAGATGAGGG - Intergenic
1103431189 12:120888375-120888397 TTGGCTGCTATGAATAATGTGGG - Intronic
1103852673 12:123943512-123943534 CTGGCTGCGGTGCCTGAAGAGGG + Intronic
1104759231 12:131287121-131287143 GTGTCTGCTGTGGATGATGGGGG - Intergenic
1104821380 12:131679375-131679397 GTGTCTGCTGTGGATGATGGGGG + Intergenic
1104914365 12:132257264-132257286 CTGGCTCCTGTGAACCCTGAGGG + Intronic
1105688188 13:22807143-22807165 TTGGCTACTGTGAATAATGCTGG - Intergenic
1106118353 13:26836932-26836954 ATGGATGCAGTGAAGGATGAAGG - Intergenic
1106387358 13:29301119-29301141 CTAGCTGATGTGAGGGATGAGGG + Intronic
1106485104 13:30165397-30165419 CTGGTTGCTGTGAAGATTGAAGG + Intergenic
1106787777 13:33124194-33124216 CTGGCTCCTGTGAAAAAGGAAGG - Intronic
1107662529 13:42653809-42653831 CTGGGTGCTCTGTATGTTGAAGG - Intergenic
1107900962 13:45013241-45013263 CAGGCTGCTTGGTATGATGAAGG - Intronic
1108282508 13:48874073-48874095 CTGACAGTTGTGACTGATGAGGG + Intergenic
1108298724 13:49052893-49052915 GTGGCTGCTGTGGGAGATGAGGG + Intronic
1108469790 13:50756390-50756412 GTGGCTGCTGTGGGAGATGAGGG + Intronic
1108664773 13:52618580-52618602 CTGGCTGCTTTGGAGGATTATGG + Intergenic
1109453241 13:62546458-62546480 CTGACCACTGTGAAGGATGAGGG + Intergenic
1109707009 13:66108660-66108682 CTGGGAGATGTGAATGAAGAAGG - Intergenic
1110816441 13:79865618-79865640 TTGGCTGCTTAGAATGAAGAGGG + Intergenic
1111160943 13:84394193-84394215 GTGGCTGCTGTGCAGGATGAAGG + Intergenic
1112111476 13:96304506-96304528 GTGACTGATGTGACTGATGATGG + Intronic
1112556436 13:100472643-100472665 GTGGCTGGTTTGAATAATGATGG + Intronic
1113329948 13:109317924-109317946 GTGGCTGCTGTGGAGGACGAAGG - Intergenic
1113954641 13:114091179-114091201 CTCCCTGCTGTGAAAGATGAAGG + Intronic
1115817513 14:37178731-37178753 CCAGCTGCTGTGAGTGTTGATGG + Intergenic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1116622696 14:47226152-47226174 CTAGCTGCAGTGAGTTATGATGG + Intronic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117224950 14:53647036-53647058 CTGGCTGCTGGGGAAGATGGTGG + Intergenic
1119585729 14:75833073-75833095 TTGGCTGAGGAGAATGATGAAGG - Intronic
1119932079 14:78557093-78557115 CAGGCTGCAGTGCATGATCATGG + Intronic
1120880108 14:89409029-89409051 CTGGCTGCTGTGAGAGGTGCAGG - Intronic
1120919936 14:89745410-89745432 CTGGCTGGGGTGATTGATGCTGG + Intergenic
1121315813 14:92960435-92960457 GCGGCTTCTGTGAAGGATGAGGG - Intronic
1123753288 15:23374872-23374894 ATGGATGATGTAAATGATGATGG - Intergenic
1123772997 15:23547961-23547983 ATGGCTGGTGAGAATGAGGAAGG - Intergenic
1123919739 15:25061973-25061995 CTGCCTGCTGTCAAGGAAGATGG + Intergenic
1124446365 15:29737340-29737362 CTGGCTGGTGGAAATGATGTTGG - Exonic
1125101001 15:35912455-35912477 CTAGCTGGTGAGAATAATGACGG - Intergenic
1125269403 15:37921639-37921661 GTGGCTGCTGTGAGGGATGCGGG + Intergenic
1127051585 15:55089515-55089537 CAGGCAGCTGTAAAAGATGAGGG + Intergenic
1129272717 15:74427937-74427959 CTGGCTGCCCTCCATGATGAGGG + Intronic
1130096350 15:80859112-80859134 CTGGCTGCTGTGATTGGTGCAGG - Intronic
1132686339 16:1163689-1163711 CTGGCCGCTGTGTCTGAGGATGG + Intronic
1133070456 16:3243401-3243423 CTGGGTGGTGATAATGATGAAGG - Exonic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1136041570 16:27583587-27583609 CTGGCTGCTGTCACTGACCATGG + Intronic
1138903639 16:61303947-61303969 GTGGCTGGTGTGAATGAGCAGGG - Intergenic
1139314085 16:66053130-66053152 CTTCCTGCTGTGGAAGATGAGGG - Intergenic
1139987917 16:70915817-70915839 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1140112408 16:72015279-72015301 CTGGCTGCTGGGAATGCAGCTGG - Intronic
1141444365 16:84048510-84048532 CTGGCTACTGTGAATAGTGCAGG + Intergenic
1141565825 16:84900983-84901005 GAGGCTGCAGTGAATCATGATGG + Intronic
1141813850 16:86395792-86395814 CTTGGTGCTGGGAATGGTGAGGG + Intergenic
1142016260 16:87749646-87749668 GAGGCTGCAGTGAGTGATGATGG - Intronic
1142617853 17:1146951-1146973 GTGGCTTATGTGAAGGATGAAGG - Intronic
1143875914 17:9990657-9990679 CTTGCTGCTCTCTATGATGAAGG - Intronic
1144281183 17:13728342-13728364 ATGGCTGCTGTGAAAAATGCTGG + Intergenic
1144326572 17:14187802-14187824 CTGGATGCTGAGAGTGATCATGG + Intronic
1144475451 17:15584668-15584690 CTGGATGCTGAGAGTGATCATGG + Intronic
1144500712 17:15784799-15784821 ATGGAGGCTGTGATTGATGAAGG + Intergenic
1144538116 17:16111743-16111765 CTGGCTCCTGTGATTGTGGAGGG - Intronic
1146728541 17:35174753-35174775 AGGGCTGCAGTGAATGATGATGG + Intronic
1147131797 17:38414071-38414093 CAGGCTACAGTGAATGGTGATGG + Intergenic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1148792359 17:50180540-50180562 CGGGCATCTGTGCATGATGAGGG - Intergenic
1149579645 17:57740539-57740561 CTGATTGCTGTGGATGCTGAGGG + Intergenic
1153266450 18:3275029-3275051 ATGGCTGCTGTGAATAGTGCTGG - Intronic
1153435186 18:5061453-5061475 CTAGCAGCTGGGAAAGATGAGGG - Intergenic
1155359986 18:24990259-24990281 CTGGCTGTTGTTAATGAAGGGGG - Intergenic
1157536637 18:48463645-48463667 CTAGCTGGTGTACATGATGAAGG - Intergenic
1157697091 18:49731449-49731471 CTGGCTGCTGTGATTGGTTCCGG + Intergenic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1160355108 18:78221179-78221201 CTGGCACCTGTGGATGAGGAGGG + Intergenic
1160523716 18:79523321-79523343 CTCTATGCTGGGAATGATGAGGG - Intronic
1160810146 19:1009803-1009825 CTGGCTGCTGCCACTGATGTTGG + Exonic
1162601245 19:11671645-11671667 TTGGCTACTGTGAATTAAGATGG + Intergenic
1162907116 19:13830680-13830702 GTGGATGCTGCGAATGATGAGGG - Exonic
1162998078 19:14348982-14349004 GAGGCTGCTGTGAGTCATGATGG + Intergenic
1163820324 19:19492772-19492794 CTGGCCGCTGACATTGATGAGGG - Intronic
1164439113 19:28258555-28258577 ATAGCTGCTGTTACTGATGAAGG + Intergenic
1164668936 19:30062304-30062326 CTGGTTGCTTTGGTTGATGAGGG - Intergenic
1165160863 19:33815069-33815091 CTCGCTGCTGTGTATGTTTATGG + Intronic
1166021018 19:40029633-40029655 CTGGCTGCTGTGAGTGCACATGG - Exonic
1166560250 19:43728061-43728083 CTGGCACCTGTGGATGATGGTGG + Exonic
1166560367 19:43728886-43728908 CCACCTGCTGGGAATGATGAAGG + Exonic
1166763728 19:45240167-45240189 CAGGCTGCAGTGAACTATGATGG - Intronic
1168322596 19:55518756-55518778 GTGGCTGCTGTGAGGGATGTGGG + Exonic
926202379 2:10811430-10811452 CAGGCTGCAGTGAACTATGATGG + Intronic
926728196 2:16014713-16014735 CTGGCTGCAGTGAGAGAAGATGG - Intergenic
928789809 2:34936383-34936405 CTGCCCACTGTGAAGGATGATGG + Intergenic
930965359 2:57317253-57317275 CTGGCTTCAGGGAATGAGGAAGG - Intergenic
931919985 2:67004712-67004734 CAGGCTGCTGAGAATCGTGAAGG + Intergenic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
933090076 2:78107997-78108019 CTGGCTGTTGAGAATGATAGGGG - Intergenic
933289375 2:80420801-80420823 CTGACTGCTGTCATGGATGATGG - Intronic
934790629 2:97056831-97056853 CTGGCTGCTGAAACTGATGCTGG + Intergenic
934815831 2:97325698-97325720 CTGGCTGCTGAAACTGATGCTGG - Intergenic
934821864 2:97382785-97382807 CTGGCTGCTGAAACTGATGCTGG + Intergenic
935161315 2:100531844-100531866 CTGCGTGCTGAGAAGGATGAAGG + Intergenic
935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG + Intronic
935899185 2:107772525-107772547 CTGACTGCTCTGATTAATGAGGG + Intergenic
937521781 2:122720949-122720971 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
937890733 2:126936593-126936615 CTTGCTGCTGTGAGTGAAGTTGG - Intergenic
938257775 2:129873363-129873385 CTGAATGCTGTGAATAAAGATGG - Intergenic
938938739 2:136149951-136149973 CTTGCTGCTGGGAATGCTGCTGG + Intergenic
940875858 2:158896411-158896433 TTGGCTCCTGTGAATAATGTTGG + Intergenic
941593849 2:167451859-167451881 GTGGCTGCTGTGGAGGATGGCGG + Intergenic
941889781 2:170568026-170568048 CTGGCTGCTTTGAAAGCTGAGGG - Intronic
942731836 2:179068898-179068920 CTGGCTAATGTGAATGATGAAGG - Intergenic
944471828 2:200062118-200062140 CTGGCTGATGTCAATGTTGCTGG - Intergenic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
946610238 2:221449924-221449946 ATGGCTGCTGTGAATCTTCATGG - Intronic
947595552 2:231409566-231409588 CTGGCTTCTGAGGATGAGGAGGG - Intergenic
947862817 2:233374397-233374419 AAGGCTGCAGTGAGTGATGATGG - Intronic
947879069 2:233489294-233489316 CTGGCTGGTGTGAGGGATGGAGG - Intronic
948720992 2:239899819-239899841 CTGGTGACTGTGGATGATGATGG - Intronic
1170727612 20:18943648-18943670 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1171537270 20:25905828-25905850 GAGACTGCTGTGAATGATTATGG - Intergenic
1171840223 20:30201163-30201185 GAGACTGCTGTGAATGATTATGG - Intergenic
1173079839 20:39855145-39855167 TTGGCTACTGTGAATCATGCTGG + Intergenic
1173455245 20:43196436-43196458 CTGGCTGCTGTGTGTGGGGAGGG - Intergenic
1174603807 20:51745757-51745779 CTGGCTACTGTGCTGGATGATGG - Intronic
1175110187 20:56642391-56642413 TTGGCTGCTGTGCATTATTAAGG + Intergenic
1178038201 21:28608876-28608898 GTGGCTGCTGTGAGGGATGGGGG - Intergenic
1178732864 21:35120728-35120750 ATGGCTGCTGTGGGGGATGAGGG - Intronic
1179218490 21:39386907-39386929 GAGGCTGCTGTGAGTTATGATGG - Intronic
1180059476 21:45377161-45377183 CTGGCTGCTGGGCATGTTGATGG + Intergenic
1180617042 22:17135174-17135196 GTGGCGTGTGTGAATGATGATGG + Intergenic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1181042995 22:20201670-20201692 CTTGCAGCTGTGACTGATGATGG + Intergenic
1181482503 22:23209469-23209491 TTGGCTGTTGTGAATAATGTTGG + Intronic
1181954101 22:26575668-26575690 CCCGCTGCTGTAAATGATGATGG + Intronic
1183462086 22:37957525-37957547 CTGTCTTGTGTGACTGATGAGGG + Intronic
1184231488 22:43160502-43160524 CTGGCTCCTGTGAGTGCTGGAGG + Intronic
1185119697 22:48958588-48958610 CTGGCTGCTGGGCAGGCTGATGG + Intergenic
949902528 3:8829318-8829340 ATGGCTGCAGAGAATAATGAGGG + Intronic
950188839 3:10962271-10962293 CTGGCAGCTGTGACTGCTAATGG + Intergenic
951841324 3:27037256-27037278 CTGCCTGCAGTGAATGATTATGG + Intergenic
954472220 3:50707765-50707787 CTGGGTGGTGTGCATGATGTTGG + Intronic
955940343 3:64141199-64141221 ATGGCTGATGTGAATGACCATGG - Intronic
956727079 3:72164900-72164922 CTTGATCCTGTGAATGATGAAGG + Intergenic
959275231 3:104269656-104269678 GTGGCTGCTGTGAGGGAAGAAGG + Intergenic
961621806 3:128230258-128230280 CTGGCTACTCTGAAGGTTGAAGG - Intronic
964744379 3:159998680-159998702 CTGCCTGGTGTGAAGTATGAGGG + Intergenic
964745641 3:160010133-160010155 ATGGCTGCAGTGAGTCATGATGG - Intergenic
965190952 3:165529089-165529111 CTGCATGATGTGAATTATGAAGG + Intergenic
967270817 3:187730736-187730758 TTGTCTCCTGTGAGTGATGACGG - Intronic
967752332 3:193128701-193128723 CTGGCCCCTGTGGATGGTGAGGG + Intergenic
968725000 4:2242632-2242654 CGGGCTGCTGTGAATGTTCCGGG - Intergenic
968742387 4:2337804-2337826 GAGGCTGCAGTGAATGGTGATGG + Intronic
969685583 4:8672282-8672304 CTAGCTGCTGGGAATGTTGCTGG - Intergenic
969710937 4:8843045-8843067 CTGTCTCCTCTGAATGGTGAAGG + Intergenic
970312064 4:14793123-14793145 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
971205644 4:24565751-24565773 CTTGCTGCTGTTGGTGATGATGG - Intronic
972266643 4:37466523-37466545 CTGGCTGCTGTGTAGGAAGAAGG + Intronic
972270018 4:37502184-37502206 CTGGCATGTGTGAATGAGGATGG - Intronic
972668917 4:41195292-41195314 GAGGCTGCTGTGAATGGAGATGG - Intronic
973144440 4:46806948-46806970 TTGGCTGCTGTAAATAATGCTGG + Intronic
973759109 4:54100755-54100777 CAGGCTGCTGGGGCTGATGATGG - Exonic
974071231 4:57126203-57126225 AAGGCTGCAGTGAGTGATGATGG - Intergenic
974116578 4:57586478-57586500 CTGGCTTCTGTGACTGGTTAAGG + Intergenic
975003290 4:69253556-69253578 CTAGCTGGGGTGATTGATGAAGG + Intergenic
975011574 4:69360917-69360939 CTAGCTGGGGTGATTGATGAAGG + Intronic
975197354 4:71541365-71541387 CTGGATGGTGTGAAGGAAGAAGG + Intronic
975276937 4:72513302-72513324 CCAACTGCTGTGAATGAAGAGGG - Intronic
975517251 4:75260306-75260328 GTGGCTGCTGTGAGGGATGCAGG - Intergenic
979284658 4:118909046-118909068 CAGGCTGCTGGGCATGTTGAGGG - Intronic
980841443 4:138266188-138266210 CTGGCTTCTGAGGGTGATGAAGG - Intergenic
980861058 4:138500056-138500078 GTGGCTGCTGTGGAGGATGAAGG + Intergenic
982873458 4:160613761-160613783 ATGGATACTGAGAATGATGAGGG - Intergenic
982915989 4:161209969-161209991 GTGGCTACTGTGAATAATGCTGG + Intergenic
982960322 4:161827626-161827648 GTGGCTGCTGTGGAAGATGGGGG + Intronic
983397777 4:167223959-167223981 ATGGCTGTAGAGAATGATGATGG - Intronic
983622585 4:169775713-169775735 CAGGCTGCAGTGAGTTATGATGG - Intergenic
984933330 4:184867713-184867735 GAGGCTGCAGTGAGTGATGATGG - Intergenic
985513740 5:326519-326541 TTGGCTACTGTGAATTATGATGG + Intronic
986223770 5:5794160-5794182 CTGGTTGCTGTTGATGGTGATGG + Intergenic
986318619 5:6609399-6609421 TTGGCTGCAAGGAATGATGACGG - Intronic
986744621 5:10732600-10732622 TTGGCTATTGTGAATAATGATGG + Intronic
987030409 5:13971995-13972017 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
987527620 5:19073798-19073820 GTGGCTGCTGTGGGGGATGAGGG - Intergenic
989627725 5:43447648-43447670 CTGGCTTCTGTTTATGCTGAGGG - Intronic
992351319 5:75932113-75932135 CTGGCTTCTGGGAATGCTGTTGG + Intergenic
992706557 5:79400807-79400829 GAGGCTGCAGTGAATTATGATGG - Intronic
993476223 5:88368288-88368310 CTTTATGCTGTGAATGAAGAAGG - Intergenic
993969981 5:94407406-94407428 TTGGCTGTTATGAATGATGCTGG - Intronic
994062214 5:95491588-95491610 GAAGCTGCTGTGAAGGATGAAGG - Intronic
994106169 5:95951723-95951745 CTAGCTGCTGTGGATTATGGGGG + Intronic
995351383 5:111179813-111179835 CTGGCTGCAGAGAATGATTTAGG + Intergenic
995704117 5:114968125-114968147 TTGTCTACTGTGAATGATGATGG - Intergenic
996523723 5:124454967-124454989 CTGGCAACTGAGAATGTTGAGGG + Intergenic
998339049 5:141400042-141400064 CTGGTTGCTGTGCGTGATGGTGG + Exonic
999072055 5:148753962-148753984 TTGGCTGTTGTGAATAATAATGG + Intergenic
1000275562 5:159731781-159731803 CTGGCTACAGTGCAAGATGATGG - Intergenic
1002169905 5:177369187-177369209 CTGGACTCTGGGAATGATGAGGG - Intronic
1004012370 6:11702108-11702130 CTTCCTCCTGTGAAGGATGAAGG - Intergenic
1004919834 6:20366290-20366312 CTGACTGCAGTGAATGAAAATGG + Intergenic
1006609850 6:35287777-35287799 CTGGCAGCAGAGGATGATGAGGG + Exonic
1006621759 6:35370208-35370230 CTGGCTGTTGGGAAAGATGGTGG + Intronic
1006670546 6:35727576-35727598 CAGGCTTCTGTGAAGGATCAGGG + Intronic
1007509275 6:42363054-42363076 CTGGCTGTGGAGAATGCTGAAGG - Exonic
1008528624 6:52433850-52433872 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1009453172 6:63825219-63825241 GTGGCTGCTGTGGAGGATGGGGG - Intronic
1010210499 6:73359356-73359378 GAGGCTGCTGTGAACTATGATGG + Intergenic
1010986255 6:82427934-82427956 CTGGCTAGTGTGATTGATTAAGG - Intergenic
1011156629 6:84340824-84340846 GTGGCTGCTGTGGATGATGGGGG + Intergenic
1011634246 6:89355074-89355096 CAGGCTGCAGTGAGTCATGATGG + Intergenic
1011856473 6:91699078-91699100 CTAGCTGATGTAATTGATGAAGG - Intergenic
1014524676 6:122488493-122488515 GTGGCTGCAGTGAACCATGATGG - Intronic
1015095818 6:129414674-129414696 CTTGCTGGTGTAAAGGATGAGGG - Intronic
1015753757 6:136587668-136587690 CTGACTGCTGTTAAGGATGTTGG - Intronic
1018271352 6:162081854-162081876 CTAGCTACGGTCAATGATGAAGG - Intronic
1018394090 6:163364017-163364039 CTGGCTGCAGTGAGCTATGACGG - Intergenic
1018684283 6:166291349-166291371 ATGGGTGCTGGGAAGGATGAGGG - Intergenic
1019123471 6:169824014-169824036 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
1019919418 7:4153739-4153761 GAGGCTGCAGTGAACGATGACGG - Intronic
1020085833 7:5309665-5309687 GTGGCTGCAGTGAGTCATGATGG - Intronic
1020908437 7:14096192-14096214 GAGGCTGCAGTGAATCATGATGG + Intergenic
1020991519 7:15202567-15202589 CTGACTAATGTGAAGGATGATGG - Intronic
1022143778 7:27516399-27516421 TTGCTTGCTGTAAATGATGAAGG - Intergenic
1022260009 7:28695160-28695182 CAGGCTGCAGTGAGTCATGATGG + Intronic
1022391162 7:29945775-29945797 CTGGCTGTTATGAAAGAGGATGG + Intronic
1022396974 7:29997817-29997839 CAGGCTGCAGTGAACCATGAAGG - Intergenic
1023015001 7:35958201-35958223 CTGGCAGCTGTGACTTATCATGG + Intergenic
1023686343 7:42739330-42739352 CTGGCTGGTGAGAGAGATGACGG - Intergenic
1024066004 7:45736823-45736845 CTGGCAGCTGTGACTTATCATGG - Intergenic
1024174762 7:46827729-46827751 GTGGCTGCTGTGAGGCATGAGGG - Intergenic
1025208470 7:57007485-57007507 GTGGCTGCAGTGAGTCATGATGG + Intergenic
1025217145 7:57067986-57068008 CTGGCAGCTGTGACTTATCATGG - Intergenic
1025288746 7:57692658-57692680 GAGACTGCTGTGAATGATTATGG - Intergenic
1025663479 7:63569393-63569415 GTGGCTGCAGTGAGTCATGATGG - Intergenic
1025766203 7:64453922-64453944 TTGGCTACTGTGAATGGTGCTGG + Intergenic
1026311918 7:69193436-69193458 TTGGCTGCTGCGAATAATGCTGG - Intergenic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1027054943 7:75043390-75043412 CAGGCTGATGTGAATGGTGATGG - Intronic
1029380515 7:100211419-100211441 CTGACTGCTGGGAATGAAGCAGG - Exonic
1032558565 7:132863703-132863725 CTGCCTACTGTCATTGATGAAGG - Intronic
1033465683 7:141587349-141587371 CTGGCTGCAGTGTGTGAAGAAGG - Intronic
1033506958 7:142013149-142013171 AAGGCTGCTGTTAATGGTGAAGG + Intronic
1034610981 7:152368290-152368312 CTGGCAGCTGTGACTTATAATGG + Intronic
1034879646 7:154753426-154753448 CTGTCTCCTGTGGAGGATGATGG - Intronic
1035342725 7:158174505-158174527 GTGGATGGTGTGGATGATGATGG - Intronic
1036048163 8:5166898-5166920 CAGGCTGCTGTGAATGACCCTGG - Intergenic
1036706642 8:11051709-11051731 CTGGCTGCTGTGTAGGGTGGAGG - Intronic
1037100549 8:15039188-15039210 TTGGCTATTGTGAATGATGCTGG - Intronic
1037433604 8:18840209-18840231 TTAGCTGCTGAGAATGATGTGGG - Intronic
1038409422 8:27346577-27346599 CATGCTGCTGTGAGTGATGGAGG + Intronic
1039125612 8:34197823-34197845 CTGGCTTCTGTGAATAATTGGGG + Intergenic
1040906491 8:52474520-52474542 CAGGCTGCTGTTAAAGATGGGGG - Intergenic
1041394874 8:57379826-57379848 CTGGATGCTGGAAATGATCAGGG + Intergenic
1041506725 8:58607415-58607437 CTAGCTGCTATGAATGGTGGAGG + Intronic
1041760281 8:61359151-61359173 CTTAGTTCTGTGAATGATGAGGG - Intronic
1041877991 8:62712411-62712433 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1042789595 8:72588829-72588851 AAGGCTGCTGTGAACTATGATGG + Intronic
1043025917 8:75068628-75068650 TTGACTGCTGTGAATAAAGATGG - Intergenic
1043331707 8:79124538-79124560 CTTGCTGTTGTGACTGATGCAGG + Intergenic
1046478112 8:114776383-114776405 GTGGCTGCAGTGAAATATGAGGG + Intergenic
1046567714 8:115922144-115922166 CTGGCTACTGCCTATGATGAAGG - Intergenic
1046769399 8:118103209-118103231 GAGGCTGCAGTGACTGATGATGG - Intronic
1047482117 8:125293705-125293727 CTGAATGCTGTGAGAGATGATGG + Intronic
1049713939 8:144080719-144080741 CTGGCTCCTGGGGATGATTAGGG + Intergenic
1050738327 9:8790079-8790101 GAGGCTGCCGTGAGTGATGATGG - Intronic
1051143791 9:14005938-14005960 CCAGCTGCTGGGAGTGATGATGG - Intergenic
1051484310 9:17591798-17591820 GTTGCTGCTGTGAATGATTCAGG + Intronic
1051801942 9:20944662-20944684 TTGGCTGCTGTGGCTCATGAGGG - Exonic
1052276327 9:26680746-26680768 GAGGCTGCAGTGAGTGATGACGG - Intergenic
1052584476 9:30408585-30408607 TTGGCTGCTGTGAATAGTGTTGG - Intergenic
1055399143 9:75904859-75904881 TTGGCTACTGTGAATAATGATGG - Intronic
1055686347 9:78779180-78779202 TGGGCAGCTCTGAATGATGAAGG + Intergenic
1056280783 9:85039405-85039427 ATGGATGATGTGGATGATGAGGG + Intergenic
1056574968 9:87849163-87849185 CTGGCTGCTCTGGTTGATGTTGG - Intergenic
1057711694 9:97451352-97451374 CAGGCTGCAGTGAGTTATGATGG - Intronic
1057755709 9:97833404-97833426 CTGGCTGTTGAGAATGTTGCTGG - Intergenic
1057856832 9:98607762-98607784 CTGGCAGCTGTGACTTATAATGG + Intronic
1057919492 9:99085152-99085174 CTTGATGCTCTGAGTGATGAGGG + Intergenic
1061970799 9:134044210-134044232 CTGGGTCCTGTGGGTGATGATGG - Intronic
1203611791 Un_KI270749v1:14294-14316 GAGACTGCTGTGAATGATTATGG + Intergenic
1186335736 X:8585314-8585336 GTGGCTGCTGTGAATGTGCATGG - Exonic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186981162 X:14959080-14959102 CTGTGTGTTGTGAAAGATGATGG - Intergenic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1190095287 X:47474811-47474833 GAGGCTGCAGTGAGTGATGATGG + Intronic
1191642439 X:63441900-63441922 CTGGCATATGTGAATGAGGAAGG + Intergenic
1193423761 X:81316145-81316167 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1194161577 X:90459104-90459126 CTGGCTGCTGTGTCTGCTAATGG + Intergenic
1194267820 X:91777510-91777532 CTGGATACTGTGAATAATGAAGG + Intergenic
1194353391 X:92850968-92850990 CTGGCTGTTGTGAAACAGGAAGG - Intergenic
1194466212 X:94237689-94237711 GTGGCTGCTGTGAGGGATGGGGG + Intergenic
1197258393 X:124288962-124288984 CTGGCTATTGTGAATAATGCTGG + Intronic
1197476312 X:126929616-126929638 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
1197671658 X:129284400-129284422 GTGGCTGCTGTGGGTGATGGGGG + Intergenic
1200507865 Y:4036837-4036859 CTGGCTGCTGTGTCTGCTAATGG + Intergenic
1200585030 Y:4998435-4998457 CTGGATACTGTGAATAATGAAGG + Intergenic
1200661750 Y:5968042-5968064 CTGGCTGTTGTGAAAGAGGAAGG - Intergenic
1201192731 Y:11460976-11460998 GTGGCTGCAGTGAGTAATGATGG - Intergenic
1201228468 Y:11840611-11840633 CGTGCTGCTGTGAAGAATGAGGG + Intergenic
1201265343 Y:12201078-12201100 CTGCCAGATGTGAGTGATGATGG + Intergenic
1201427655 Y:13871729-13871751 GTGGCTGCTGTGAATGTGCATGG + Intergenic