ID: 1026378795

View in Genome Browser
Species Human (GRCh38)
Location 7:69778490-69778512
Sequence CTGCACATTACAACTATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026378795_1026378802 12 Left 1026378795 7:69778490-69778512 CCCCAGATAGTTGTAATGTGCAG No data
Right 1026378802 7:69778525-69778547 CTTACTGCTCTAACGTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1026378795_1026378803 26 Left 1026378795 7:69778490-69778512 CCCCAGATAGTTGTAATGTGCAG No data
Right 1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG No data
1026378795_1026378801 11 Left 1026378795 7:69778490-69778512 CCCCAGATAGTTGTAATGTGCAG No data
Right 1026378801 7:69778524-69778546 ACTTACTGCTCTAACGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026378795 Original CRISPR CTGCACATTACAACTATCTG GGG (reversed) Intronic