ID: 1026378796

View in Genome Browser
Species Human (GRCh38)
Location 7:69778491-69778513
Sequence ACTGCACATTACAACTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026378796_1026378803 25 Left 1026378796 7:69778491-69778513 CCCAGATAGTTGTAATGTGCAGT 0: 1
1: 1
2: 5
3: 30
4: 286
Right 1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG No data
1026378796_1026378801 10 Left 1026378796 7:69778491-69778513 CCCAGATAGTTGTAATGTGCAGT 0: 1
1: 1
2: 5
3: 30
4: 286
Right 1026378801 7:69778524-69778546 ACTTACTGCTCTAACGTGTCAGG No data
1026378796_1026378802 11 Left 1026378796 7:69778491-69778513 CCCAGATAGTTGTAATGTGCAGT 0: 1
1: 1
2: 5
3: 30
4: 286
Right 1026378802 7:69778525-69778547 CTTACTGCTCTAACGTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026378796 Original CRISPR ACTGCACATTACAACTATCT GGG (reversed) Intronic