ID: 1026378803

View in Genome Browser
Species Human (GRCh38)
Location 7:69778539-69778561
Sequence GTGTCAGGGCCACAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026378795_1026378803 26 Left 1026378795 7:69778490-69778512 CCCCAGATAGTTGTAATGTGCAG 0: 1
1: 1
2: 5
3: 78
4: 442
Right 1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG No data
1026378797_1026378803 24 Left 1026378797 7:69778492-69778514 CCAGATAGTTGTAATGTGCAGTA 0: 1
1: 0
2: 3
3: 19
4: 130
Right 1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG No data
1026378796_1026378803 25 Left 1026378796 7:69778491-69778513 CCCAGATAGTTGTAATGTGCAGT 0: 1
1: 1
2: 5
3: 30
4: 286
Right 1026378803 7:69778539-69778561 GTGTCAGGGCCACAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026378803 Original CRISPR GTGTCAGGGCCACAGAACTT TGG Intronic
No off target data available for this crispr