ID: 1026381059

View in Genome Browser
Species Human (GRCh38)
Location 7:69799791-69799813
Sequence CCTCCTGGTGCTGTTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026381050_1026381059 7 Left 1026381050 7:69799761-69799783 CCTCATTAGAAATCTAAGCTCTC 0: 1
1: 0
2: 0
3: 20
4: 155
Right 1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG 0: 1
1: 0
2: 5
3: 26
4: 275
1026381049_1026381059 22 Left 1026381049 7:69799746-69799768 CCTCAGTCTTTTTTTCCTCATTA 0: 1
1: 0
2: 6
3: 81
4: 810
Right 1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG 0: 1
1: 0
2: 5
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026381059 Original CRISPR CCTCCTGGTGCTGTTCCTTG AGG Intronic
900302614 1:1985680-1985702 CCCCCTGGGGCTGTGCCATGTGG - Intronic
900885927 1:5415348-5415370 CCCCCTGCTGCTGTGCCCTGTGG - Intergenic
900996100 1:6124449-6124471 GCTCCTGGTGCTGTCCCTTGTGG - Intronic
900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG + Exonic
901129096 1:6951028-6951050 CCTCCTTTTGCTTTTCCTTGTGG + Intronic
901714132 1:11139601-11139623 CCTTATGGTGCGGTCCCTTGTGG - Exonic
902217695 1:14945009-14945031 CAGCCTGGTGCTGTCCCCTGCGG - Intronic
907610011 1:55859743-55859765 CATCCAAATGCTGTTCCTTGTGG - Intergenic
908341900 1:63189933-63189955 CCCCCTGGTGTTGTTCAATGTGG - Intergenic
911052331 1:93681549-93681571 CCTCGGGGTGCTGTTCCTCCCGG - Intronic
912201968 1:107468620-107468642 CCACATGGAGCTGTTCTTTGTGG - Intronic
913182336 1:116334225-116334247 CCTCCTGCTGCTGTTTCTGTTGG + Intergenic
914335771 1:146713947-146713969 CAAACTGGTACTGTTCCTTGGGG - Intergenic
915244073 1:154543969-154543991 CTTCCTGGTGCTGCTCCTGAGGG + Exonic
915834207 1:159161783-159161805 ACTGCTGCTGCTATTCCTTGTGG - Intergenic
915902408 1:159856132-159856154 CCTCCTGGTGCTGTTCCCTCAGG - Intronic
916257329 1:162802544-162802566 CCTCCAGGTTCTGTTGCTTAGGG + Intronic
916860215 1:168795412-168795434 CCTCCTGCTTCTCTTCCCTGTGG - Intergenic
919675410 1:200377446-200377468 TCTCCTGCTGCTATTCCCTGGGG + Intergenic
920199436 1:204250485-204250507 CCTCCTGCTGCTGTCCTCTGCGG - Intronic
922709382 1:227815767-227815789 CCTTCTGCTGCTGCTCCTGGTGG + Exonic
923018614 1:230145997-230146019 CCTGCTTCTGGTGTTCCTTGAGG + Intronic
923199128 1:231694597-231694619 TGGCCTGGAGCTGTTCCTTGCGG - Exonic
1063344461 10:5298209-5298231 TTTCCTGGTCCTCTTCCTTGTGG - Intergenic
1063352999 10:5373747-5373769 GCTCCTGCTGCTGCTCCTGGGGG + Exonic
1063386216 10:5617748-5617770 CCTCCTGCTGCTGTTCTGCGTGG - Intergenic
1066460410 10:35608098-35608120 CCTGCTGATGCTGTTCCTCTGGG + Exonic
1066723779 10:38368237-38368259 CCTCCAGGTTCTGTTGCTTAGGG + Intergenic
1067239667 10:44479579-44479601 CCTCCTTGTGCAGGGCCTTGTGG - Intergenic
1068045674 10:51883160-51883182 ACTCCTGGTTCTCTTGCTTGAGG + Intronic
1070354213 10:75623649-75623671 CCTCCTTGTGCTGTTCTTCCAGG - Intronic
1070443811 10:76474408-76474430 ACTCCTGATGATGTTCTTTGAGG - Intronic
1070935480 10:80291330-80291352 CCCCATGGTGCTGTTACTTATGG - Intergenic
1071009483 10:80920859-80920881 CCTCCTCTGGCTGCTCCTTGTGG - Intergenic
1071250314 10:83811619-83811641 TCTCCTGGACCCGTTCCTTGAGG + Intergenic
1072917530 10:99548289-99548311 CCTTCCTGGGCTGTTCCTTGAGG + Intergenic
1073321039 10:102616463-102616485 CCTCCAGGTCCTGTTCATTCTGG - Intronic
1075049967 10:119176234-119176256 CCTCCTGTTTCTGTTCATGGCGG - Intronic
1077390807 11:2299989-2300011 CCTCCTGGGCCAGCTCCTTGGGG + Intronic
1077587476 11:3464810-3464832 CCTCCTGGTGTTATTCGTTGTGG - Intergenic
1077851715 11:6079586-6079608 CCTGCTGGGGCTATTCCCTGGGG - Intergenic
1078367345 11:10717742-10717764 CCTCATGGTGCTTATCCTTCTGG - Intergenic
1079188125 11:18255176-18255198 CTTCCTGGTGCAGTCCCCTGTGG + Intergenic
1080686149 11:34516555-34516577 GCTCCTGGGGCAGTTCTTTGCGG + Intergenic
1082835569 11:57648184-57648206 CCCCCTTCTGCTGTTCGTTGTGG - Exonic
1084080250 11:66818467-66818489 ATTCCTGGGGCTGTTCCCTGTGG + Intronic
1084547310 11:69820863-69820885 CCTCTTGCTGCTGTCCTTTGGGG - Intergenic
1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG + Intergenic
1085826522 11:79853447-79853469 CCTGCTCGTGCTGTTCCCTCAGG + Intergenic
1086324566 11:85685404-85685426 CCTGCTGGTGCTGCTGCTTGAGG + Exonic
1090725786 11:129526239-129526261 CCTCTTGCTGCTTTTCCTAGAGG - Intergenic
1091856115 12:3741737-3741759 ACTCCTAATGCTGTTCCTTTAGG - Intronic
1092111131 12:5965585-5965607 CCTCCTGCTGCTCTCCCTTTAGG + Intronic
1092413722 12:8273563-8273585 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1093746905 12:22752420-22752442 CCTGCTGACCCTGTTCCTTGGGG - Intergenic
1093908774 12:24722469-24722491 TCTCCTGGTGTTGTGCCATGAGG + Intergenic
1096148876 12:49296506-49296528 CCTCCTCGTGCAGCTTCTTGAGG - Exonic
1101132431 12:101703124-101703146 CCTCCTGGTGCATTTGATTGGGG + Intronic
1101880816 12:108624271-108624293 CCTCCTGTTGCTGATCCTACTGG - Exonic
1102246927 12:111361976-111361998 CCTCATGGTGGTGCTCCTGGTGG - Exonic
1103561938 12:121797410-121797432 CCTCCTGCTGCTGTTCCTGCTGG - Intronic
1103594321 12:122014485-122014507 ACTCCTGCTGCTGTTCCTCCGGG - Intergenic
1104052610 12:125206199-125206221 TTTCCTGGTGCTGTGGCTTGGGG + Intronic
1104062874 12:125282683-125282705 GCTCCCGGTGCTGCTGCTTGGGG + Intronic
1106391481 13:29339111-29339133 CCTCCCGGGGCGGCTCCTTGGGG + Intronic
1106721572 13:32440367-32440389 TTTTCTAGTGCTGTTCCTTGGGG - Intronic
1109777997 13:67068423-67068445 CCTCCTATTTCTCTTCCTTGAGG - Intronic
1109799958 13:67363461-67363483 CATTCTGCTGCTATTCCTTGAGG + Intergenic
1110769863 13:79329554-79329576 CCTAGTGGTTCTGTTCCTTCTGG - Intronic
1111246215 13:85544958-85544980 CCGCCTGCTGCTGTTCCATGGGG + Intergenic
1112217526 13:97448857-97448879 CCTCCTGTTGCTTTTCCTTAGGG - Intronic
1113803260 13:113097080-113097102 CCGCCCGGGGCTGTTCCCTGCGG - Intronic
1114230049 14:20773141-20773163 CCTCCTGAGACTGTGCCTTGGGG + Intergenic
1114400879 14:22409298-22409320 CCTCAAGGTGCTCTTCCTAGTGG + Intergenic
1114769993 14:25418315-25418337 CCTACATGTGATGTTCCTTGTGG + Intergenic
1115328419 14:32167655-32167677 CCTCCTGGTGCAGTTGGCTGGGG + Intergenic
1115374972 14:32664813-32664835 CATCCTGGTCCAGTTCCTAGGGG - Intronic
1116937635 14:50758470-50758492 CCTCACGCTGCTGTTCCTGGAGG + Exonic
1116987867 14:51240328-51240350 AGTCCTGGTGCTGTTGCTTTGGG + Exonic
1122790853 14:104183618-104183640 CCTCCAGCAGGTGTTCCTTGAGG + Intergenic
1122860799 14:104581596-104581618 CCTGCTGGTGCTGTACCTCCGGG - Intronic
1202918109 14_KI270723v1_random:3424-3446 CCTGCCCGTGCTGTTCCCTGGGG + Intergenic
1202926517 14_KI270724v1_random:31163-31185 CCTGCCCGTGCTGTTCCCTGGGG - Intergenic
1123398677 15:19962905-19962927 GTTCCTGGTGCAGTTCCTGGAGG + Intergenic
1123578920 15:21698725-21698747 CCACATCCTGCTGTTCCTTGTGG - Intergenic
1123615547 15:22141207-22141229 CCACATCCTGCTGTTCCTTGTGG - Intergenic
1125490803 15:40147205-40147227 CCTTCTGGTTCTGCTCCTTGGGG - Intergenic
1126820286 15:52496442-52496464 ACTCCTGGTCCAGTCCCTTGTGG + Intronic
1127682675 15:61312734-61312756 CATCTTAGTTCTGTTCCTTGGGG + Intergenic
1127835458 15:62787439-62787461 TCTCCTGGTTTTGTGCCTTGGGG - Intronic
1128694081 15:69747369-69747391 CCTCCAGGTGCTGGTTCCTGAGG - Intergenic
1129160158 15:73742911-73742933 CCTCCAGGTGCTGTTGCTGCTGG + Intronic
1129267489 15:74401747-74401769 CCTCCTGATGCTCTTCCTGGTGG - Intergenic
1130896922 15:88178077-88178099 CCTCCTTCTTCTGTTCTTTGTGG - Intronic
1131708589 15:95026320-95026342 CCTCCTGTGGCTGCTTCTTGGGG - Intergenic
1132157351 15:99504922-99504944 CCTCCTGGAGCTCCTCCTGGAGG + Intergenic
1202987790 15_KI270727v1_random:432970-432992 CCACATCCTGCTGTTCCTTGTGG - Intergenic
1132463472 16:66928-66950 TCTCCTGGTGCAGTTCCCAGAGG - Intronic
1132769128 16:1551317-1551339 CCTCCTGCTGCTGATCCTTCGGG - Intronic
1133813485 16:9178884-9178906 CCTCCAGGTGCCCTTCCTGGAGG + Intergenic
1135629421 16:24024051-24024073 GCTCCTGGTTCTGGTCCCTGGGG - Intronic
1137308965 16:47234532-47234554 CTTCCTGGTTCTGTGGCTTGAGG - Intronic
1137496809 16:48975890-48975912 CTTCCTGGTGCTGTTGCTGAGGG + Intergenic
1139504268 16:67391291-67391313 CCTCCCGGGGCTCTTCCTTGGGG - Exonic
1139997853 16:70997281-70997303 CAAACTGGTACTGTTCCTTGGGG + Intronic
1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG + Exonic
1141804993 16:86336461-86336483 TCCCCTGTTGCTGTTCCCTGTGG - Intergenic
1142191353 16:88719696-88719718 CCGGCTGGTGCCGTTCCTGGTGG - Exonic
1144244018 17:13345478-13345500 CCTCCCAGTGCTGTTGCTTCAGG + Intergenic
1144244031 17:13345571-13345593 CCTCCCAGTGCTGTTGCTTTAGG + Intergenic
1144783186 17:17817924-17817946 ACTCCTGGCTCTGTTCCTTTCGG - Intronic
1145202176 17:20956101-20956123 CCTTCTGGTGCTGGTAATTGCGG - Intergenic
1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG + Intronic
1148091916 17:45027684-45027706 CCTTCCTGTGCTGTTCTTTGAGG - Intronic
1148191103 17:45679125-45679147 CCTCCAGGGGCTGTTCGCTGAGG + Intergenic
1150786846 17:68170053-68170075 CCTCCTGCTGCTGGCCCCTGAGG + Intergenic
1151685838 17:75646197-75646219 CCTCCTGGAACTGTTTCTGGGGG - Intronic
1151943616 17:77307389-77307411 CCTGCTGGAGATGATCCTTGTGG + Intronic
1152068637 17:78124613-78124635 CCTCCTGCTGCTGCTGCTGGTGG - Exonic
1203172816 17_GL000205v2_random:165927-165949 TTTCCTGGTGCTTTTCCATGAGG + Intergenic
1153746506 18:8185335-8185357 CCTCCTGGTGGGGCTCCTGGGGG - Intronic
1154298787 18:13174748-13174770 CCTCCACGTGCTGTTCCTACAGG - Intergenic
1158602932 18:58870530-58870552 CCTTTTGGTGCAGTGCCTTGAGG + Intronic
1159104852 18:63994172-63994194 CTTCCTGGTGCTGTTCCATGGGG + Intronic
1159460052 18:68713054-68713076 TCACCTGGTGCTGTTTCATGGGG - Intronic
1159745089 18:72223329-72223351 CCACCTTGAGCTGTTCTTTGAGG - Intergenic
1160619078 18:80157943-80157965 CCTCCCGCTGCTTCTCCTTGTGG - Exonic
1160706861 19:533924-533946 CCTGCAGCTGCTGTTCCTTCAGG + Intronic
1160711727 19:554950-554972 CGTCCTGGTGCTGTTATTTTGGG + Intergenic
1160857601 19:1224402-1224424 CCTCATGGTGCCCATCCTTGGGG + Intronic
1160887540 19:1357858-1357880 TCCCCTGTTGCTCTTCCTTGTGG + Intronic
1164833274 19:31339477-31339499 CCTCTTGGTACTGTACCCTGTGG - Intronic
1165266577 19:34666772-34666794 CCTGCTGCTGCTGTTGCTCGTGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166789808 19:45392059-45392081 TCTGCTGGTACTGTTTCTTGTGG + Exonic
1168354219 19:55691895-55691917 CCTCCAGCTGCTGATCCCTGGGG + Exonic
1168561682 19:57389868-57389890 CCTCCTGGTGGTGGTCGTTTTGG + Intronic
925470293 2:4153720-4153742 GCTGCTGCTGCTGTTTCTTGGGG + Intergenic
928080710 2:28309942-28309964 CCTCCTGGGCCTTTTCCTTATGG + Intronic
929460373 2:42098843-42098865 CCTCCTAGGCCTGCTCCTTGTGG + Intergenic
930698976 2:54440220-54440242 CTTCCTGGTTCCCTTCCTTGGGG - Intergenic
931426790 2:62178746-62178768 TCTCCTGCTGCTGTTTCTTAGGG - Intergenic
932037834 2:68265362-68265384 CCTTCTGGGTCTGTTCTTTGTGG - Intergenic
933180402 2:79220437-79220459 CTTCCTGGAGCTGCTCGTTGAGG - Intronic
934708675 2:96501797-96501819 CCTCCTGGTCCTGCTCTTTCTGG + Intronic
937217788 2:120323658-120323680 TCTTCTGGGTCTGTTCCTTGTGG + Intergenic
939376880 2:141380190-141380212 CCTCCTGGGGCTCTTCCTCTTGG + Intronic
940848015 2:158661903-158661925 CCTCCTGCTGCTGCTGCCTGTGG + Intronic
942919149 2:181349899-181349921 CCTCCTGGTTCTCCTCCCTGAGG - Intergenic
946433577 2:219638202-219638224 CATCCTGGTGATGGTCCTGGTGG + Exonic
946765520 2:223036650-223036672 CCTGCTGGGGCTCTTCATTGAGG + Intergenic
947498516 2:230656227-230656249 CCACCTGGTGCTCACCCTTGAGG + Intergenic
947542299 2:230987447-230987469 GCTCCTGATTCTGGTCCTTGGGG - Intergenic
947586413 2:231359561-231359583 GCTCCTGGTCCTGGTCCTAGAGG + Intronic
948592073 2:239056875-239056897 TCTCCTGGTTCTGTGCTTTGGGG - Intronic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
949026602 2:241769216-241769238 CCTCCTGGTGGAGGTCCTCGGGG + Intergenic
949042123 2:241854290-241854312 CTTCCTGGTGGTGTTCCCAGAGG + Intronic
1170051948 20:12155826-12155848 CACACTGGTGCTGTCCCTTGTGG - Intergenic
1170506528 20:17031323-17031345 CCTACTGCTGCTGGTCTTTGAGG - Intergenic
1170569788 20:17626314-17626336 TCTCCTGGTGGTGTTTGTTGGGG - Intronic
1171030242 20:21670212-21670234 CCTCCTGTCGCTTTCCCTTGGGG - Intergenic
1172093164 20:32447731-32447753 CCTGCTGGTGCTGGTGCTGGAGG + Exonic
1175363321 20:58432192-58432214 CTTCCTGGGGCTGTTTTTTGGGG + Intronic
1175364697 20:58444595-58444617 CCTGTTGGTGCTGGCCCTTGGGG + Exonic
1175382619 20:58574293-58574315 CCTACTGTTGCTGTTTCTTGAGG - Intergenic
1175678756 20:60969116-60969138 CCTCCTTGTGGGGTTCCTTGGGG - Intergenic
1175920050 20:62446457-62446479 CCTCCTGGGGCTGCTGCTTTGGG - Intergenic
1176000967 20:62830934-62830956 CTTCCACGTGGTGTTCCTTGTGG + Intronic
1176230997 20:64032834-64032856 CCTCCTCCTGCTGCTCCTGGGGG - Exonic
1176328809 21:5527710-5527732 TTTCCTGGTGCTTTTCCATGAGG + Intergenic
1176398948 21:6293241-6293263 TTTCCTGGTGCTTTTCCATGAGG - Intergenic
1176438209 21:6695863-6695885 TTTCCTGGTGCTTTTCCATGAGG + Intergenic
1176462471 21:7022933-7022955 TTTCCTGGTGCTTTTCCATGAGG + Intergenic
1176486032 21:7404711-7404733 TTTCCTGGTGCTTTTCCATGAGG + Intergenic
1176745367 21:10647648-10647670 GTTCCTGGTGCAGTTCCTGGAGG + Intergenic
1178962085 21:37074143-37074165 CCTCCTGGGTCCGTTCCGTGGGG - Intronic
1179988082 21:44932236-44932258 CTTCCTGGAGCTTTTCCTGGGGG + Intergenic
1180145210 21:45914943-45914965 TTTCCTGGTGCTTTTCCTTACGG + Intronic
1180191671 21:46168324-46168346 CCTCCTGGTCCTGTCCCCGGTGG + Exonic
1181389356 22:22568712-22568734 CCTTCTAGTGCTTTCCCTTGTGG + Intergenic
1181490044 22:23255969-23255991 CCTTCTGGTGCTCTTCCCAGTGG + Intronic
1181876180 22:25942739-25942761 CCACCTGCTACTGTTGCTTGGGG - Intronic
1183063300 22:35348233-35348255 CTTCGTGCTGCTGTTCCATGAGG + Intergenic
1184432971 22:44452403-44452425 CCTCCTAGCTCTGTTCCTTCTGG + Intergenic
1184580517 22:45413540-45413562 CCACCTGGAGCTGCTGCTTGTGG - Exonic
949430423 3:3969510-3969532 CGTCCTGGTTCTGCTCCCTGTGG - Intronic
950492933 3:13317104-13317126 CCTCCAGGTGCTGGTTCCTGAGG + Exonic
950543270 3:13624846-13624868 CCTCCTGGTGCTGCACCTTGTGG - Intronic
953099197 3:39809314-39809336 CCTCCCGGGGCTCTTCCCTGCGG - Intronic
953850910 3:46464831-46464853 CCTCGTCCTGCTGTTCCTCGGGG - Exonic
954140611 3:48603255-48603277 GCTCCTGGCCTTGTTCCTTGTGG - Intronic
955392499 3:58531653-58531675 CCTCCTGGCAGGGTTCCTTGAGG + Intronic
955925331 3:63998810-63998832 CCTCTACTTGCTGTTCCTTGTGG + Intronic
957058757 3:75464414-75464436 CCTCCTGGTGTTATTCACTGTGG - Intergenic
959066842 3:101666105-101666127 CCTCCAGCAGCTGTTTCTTGAGG - Intronic
959317065 3:104822128-104822150 CCTCCTGGGGCACTTCCTAGTGG + Intergenic
959319124 3:104848426-104848448 CCTACTGGGGCTGTGCCTAGTGG + Intergenic
960499828 3:118423479-118423501 CTGCCTGCTGCTGTTTCTTGTGG - Intergenic
960594653 3:119397257-119397279 TCTCATGATGCAGTTCCTTGTGG - Intronic
960798650 3:121515004-121515026 CCACCTGGGGCAGGTCCTTGAGG - Intronic
961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG + Intergenic
961608342 3:128115219-128115241 CATCCTGGTGCTGCTGCTTGCGG - Intronic
961891275 3:130132195-130132217 CCTCCTGGTGTTATTCATTGTGG - Intergenic
962448580 3:135492172-135492194 CCTCCTGCTCCAGTTCCTAGAGG - Intergenic
965718942 3:171639868-171639890 CCTATTGGTTCTGTTTCTTGAGG + Intronic
966992625 3:185249527-185249549 CCCCCTGCTGCTGTTCTGTGAGG + Intronic
968554686 4:1240926-1240948 CCCTGTGGAGCTGTTCCTTGTGG - Intronic
969002667 4:3994636-3994658 CCTCCTGGTGTTATTCATTGTGG - Intergenic
969667295 4:8567362-8567384 CCTCCTGGGGCTGTGCCAGGGGG - Intronic
969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG + Intergenic
969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG + Intergenic
970422096 4:15914886-15914908 CCTCCTGGTGCTTCCCCATGTGG - Intergenic
971318408 4:25586044-25586066 CCTCCTGCTCCTGTTGTTTGGGG + Intergenic
975096471 4:70462855-70462877 CCTCCTGCTGCAGTTCCTGCTGG - Intronic
975648274 4:76566838-76566860 CCTCATGGTTCTGTTGCTTTGGG + Intronic
976123237 4:81805553-81805575 CTTCCTGGTCCTTTTTCTTGGGG - Intronic
976344460 4:83984524-83984546 TGTCCTGGTGCTTTACCTTGGGG - Intergenic
980463892 4:133150443-133150465 CCCCCTGGAGCTGTTCCAGGTGG + Exonic
981162999 4:141521607-141521629 CCTCCTGCTCCTGTTCACTGTGG + Intergenic
981306141 4:143248769-143248791 TCCCCTGGAGCTGTTCCGTGGGG - Intergenic
985694101 5:1330300-1330322 CCTGCTGGTGCTGGTCCCGGCGG - Exonic
988900541 5:35727680-35727702 CCTCCTGATGATTTTCCTTTAGG - Exonic
989183937 5:38604752-38604774 CCTCCTGGGGCTGTGCCATGGGG - Intronic
995511749 5:112917637-112917659 CCTCCTGGTGCAGTCCCTCCAGG - Intronic
998134501 5:139667635-139667657 CCTCCTGGCACTATTCCTGGAGG + Intronic
999218959 5:149959503-149959525 ACTCCTGATGCTGCCCCTTGTGG - Intergenic
999999221 5:157121063-157121085 TCTCCTGGGGATGGTCCTTGGGG - Intronic
1000361543 5:160452347-160452369 CCTCCTGCTACTTTTCCTTGGGG + Intergenic
1001480486 5:172085943-172085965 CCTCCTTGTGCTGCTCTTGGGGG - Intronic
1001671505 5:173477910-173477932 CCGCCTGGCGCTGTCCCTGGGGG + Intergenic
1002278371 5:178117227-178117249 ACTCCTGTTGCTGCTTCTTGGGG - Intronic
1003331995 6:5136726-5136748 CCTACAGGCGCTGCTCCTTGGGG - Intronic
1003442919 6:6159901-6159923 ACTCCTGGAGCTGTTCCAGGTGG + Intronic
1003843731 6:10150358-10150380 CCTCCTCTTCCTATTCCTTGTGG + Intronic
1007881264 6:45169972-45169994 CCCCCTGGGGCTGTGCCCTGTGG - Intronic
1010194450 6:73225309-73225331 CCTCCTGGTCCTCTTCCATGTGG + Exonic
1010205993 6:73322985-73323007 CCTCATGCTGCTGTGCTTTGGGG + Intergenic
1013356751 6:109351956-109351978 TCTCCTGGCACTGCTCCTTGTGG + Intergenic
1016620384 6:146102593-146102615 TCTCCTGGTGCTGTCCCATTTGG + Intronic
1016634183 6:146268378-146268400 ATTCCTGGTGCTGTTTCTTCTGG + Intronic
1019068321 6:169321398-169321420 CCTCCTGCTGCCATCCCTTGAGG + Intergenic
1019073153 6:169366294-169366316 CCTCCTGGTGATGTTCCCGTTGG - Intergenic
1019279620 7:193235-193257 CATCCTGATGGTGTTCCTGGTGG + Exonic
1019414713 7:921991-922013 CCTCCTGCTGCTGCTGCTTCTGG - Intronic
1019860475 7:3653771-3653793 CCTTCTGGAGCTGCTCCTTTGGG + Intronic
1019867132 7:3722468-3722490 CCCCCTGGTGGTGTCCCCTGCGG - Intronic
1020013462 7:4818397-4818419 GCTCCTGGTGCTCCTCCTTCAGG + Intronic
1020321613 7:6942757-6942779 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1023377316 7:39570141-39570163 AGTCCTGGTACTGTTGCTTGGGG - Intronic
1024520536 7:50302125-50302147 CCTCCTGGTGGGGTTGTTTGTGG - Intergenic
1026288142 7:68981765-68981787 CCTCCTGGCTCTGTTCATTCTGG + Intergenic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1028587669 7:92467960-92467982 CCTCATGGTTGTGTTACTTGGGG + Intergenic
1029424588 7:100488005-100488027 CCTCCTGGGGCTGTAAGTTGAGG + Intronic
1029896388 7:103989302-103989324 CCTCCTAGCGCTGTTGCTGGGGG - Exonic
1031055866 7:116992198-116992220 CCTACTGGTGCTCTGCCTAGTGG - Intronic
1032138634 7:129306628-129306650 CCTCCTGGTCTTGATGCTTGTGG + Intronic
1033441906 7:141387727-141387749 CCTCCTGCTGCGCTTCCCTGTGG + Intronic
1034354647 7:150442999-150443021 CCTGCTGGTTCTGTGCCTTCTGG + Intergenic
1034832194 7:154319031-154319053 CCTCCTGCTGCTGGCCCTGGGGG - Intronic
1034901634 7:154911278-154911300 CCTCCTGGTGCTCACCCTTGTGG + Intergenic
1034960626 7:155362204-155362226 CCTCCTCCTGCAGCTCCTTGGGG - Intronic
1036034454 8:5003976-5003998 CCTCCTGGGCCTGCTCCCTGGGG - Intergenic
1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG + Intergenic
1036854981 8:12233841-12233863 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1036876340 8:12476329-12476351 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1037751597 8:21685920-21685942 CCTCCTGGGGCTCTCCCTGGAGG + Intergenic
1037841524 8:22248606-22248628 CCTCCATGTCCTCTTCCTTGGGG - Exonic
1039380789 8:37083114-37083136 CTTCCTGGTCTTGTTCTTTGTGG - Intergenic
1039904368 8:41775299-41775321 CATCCTGGCTCTGTCCCTTGGGG - Intronic
1040107104 8:43547381-43547403 CCTCCTGTTGCTGTCACCTGGGG + Intergenic
1041195882 8:55401015-55401037 GCTGCTCATGCTGTTCCTTGTGG + Intronic
1041673435 8:60515755-60515777 CCTCCAGTTGCTGTGCCTGGCGG + Intergenic
1042396330 8:68295369-68295391 TCTGTTGGTGCTGTTCCATGGGG + Intergenic
1044161028 8:88915251-88915273 CCTCCTGTTGTTGTTACATGAGG + Intergenic
1047400299 8:124540744-124540766 CCTCATTGTGCTGTTCTCTGTGG + Intronic
1049478081 8:142806112-142806134 TCTCCTGGTGCTGCTGCTTCTGG - Intergenic
1049682972 8:143927910-143927932 CCTCCTTGAGCTGCTCCTCGTGG + Exonic
1050331434 9:4549983-4550005 CAAACTGGTGCTGTTTCTTGAGG - Intronic
1051226077 9:14900519-14900541 CTTCCTAGTGCTGTTCTTGGAGG - Intronic
1051467360 9:17395708-17395730 CCTCCTGTTGCTGTTCACTAGGG - Intronic
1052198540 9:25748137-25748159 CCTCCTGTTGCTTTCCCTTTGGG - Intergenic
1052991328 9:34520880-34520902 CCTTCTTGTTCTGTTCCTTAAGG + Exonic
1053343196 9:37356931-37356953 CCACCTGTTGCTTTTCCATGAGG - Exonic
1055292763 9:74800726-74800748 CCTCCTAGTTCTGTTCCTTCAGG - Intronic
1055901461 9:81243193-81243215 CATCCTGGTGCACTTGCTTGAGG - Intergenic
1056135832 9:83628734-83628756 CCTCCTGGGGGTTGTCCTTGGGG + Intronic
1057292692 9:93817373-93817395 CTTCCTGATGGTGTTCTTTGAGG + Intergenic
1058619159 9:106864392-106864414 ACTCCTGGTGCAGTTCCCAGGGG + Intronic
1060591744 9:124821118-124821140 CATCCTGGTGCTGAGCCATGAGG - Intergenic
1061282800 9:129607177-129607199 CTTCTTGGTGCTGTTCATAGGGG + Intergenic
1061393579 9:130331307-130331329 TCTCCTGGGTCGGTTCCTTGCGG + Intronic
1061724123 9:132572218-132572240 CCTCCTGGTGCTGAGCCACGAGG - Intronic
1061805524 9:133135549-133135571 CCTCCTGGAGCTGGACCTGGGGG - Intronic
1061956316 9:133963178-133963200 CCTCCTGGTGCTGGGTCCTGGGG - Intronic
1062078244 9:134603888-134603910 CCCCCAAGTGATGTTCCTTGAGG + Intergenic
1062355179 9:136158485-136158507 CCTCCAGGGTCTGTTTCTTGAGG + Intergenic
1062664953 9:137665397-137665419 CGTCCTGGAGCTACTCCTTGTGG + Intronic
1203433299 Un_GL000195v1:112752-112774 TTTCCTGGTGCTTTTCCATGAGG - Intergenic
1186781752 X:12919331-12919353 CGTTCTGGTGCTGTACATTGGGG - Exonic
1186797619 X:13062160-13062182 CCTCCTGGGGCACTGCCTTGTGG - Intergenic
1186873728 X:13797217-13797239 CCTCCTGGCTTTGATCCTTGTGG + Intronic
1193359299 X:80561577-80561599 CCTCCTGGTCCCCCTCCTTGGGG + Intergenic
1194234273 X:91362594-91362616 CCTCCTGAGGCTGTGCCATGTGG - Intergenic
1195328998 X:103781178-103781200 CATCATGGAGCTGGTCCTTGAGG + Intronic
1198312552 X:135436247-135436269 CCTCCTGGCGCTGCACCTCGAGG - Intergenic