ID: 1026383168

View in Genome Browser
Species Human (GRCh38)
Location 7:69819584-69819606
Sequence CACAGTGGATCAGAGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026383164_1026383168 12 Left 1026383164 7:69819549-69819571 CCTGTGTAAACTATTGGCTGCCT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG 0: 1
1: 0
2: 1
3: 8
4: 132
1026383165_1026383168 -8 Left 1026383165 7:69819569-69819591 CCTGTTCATGTTGTGCACAGTGG 0: 1
1: 0
2: 2
3: 14
4: 146
Right 1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026383168 Original CRISPR CACAGTGGATCAGAGGCATA TGG Intronic
903859497 1:26356331-26356353 CATGGTGGATCAGTGGCAGAGGG + Intergenic
904009996 1:27383866-27383888 CACAGCGGATGAGGGGCAGAAGG - Intergenic
904595744 1:31644407-31644429 CACACTGCATCAGAGTCATCAGG - Intronic
904616099 1:31750749-31750771 CACAGTGTATCAGAATCACAGGG + Intronic
909949534 1:81703527-81703549 CACACTGGACCAAAGGCATCTGG - Intronic
915994477 1:160549651-160549673 TACCGTAGTTCAGAGGCATAGGG + Intronic
916606604 1:166348721-166348743 CACAGTCCATCAGTGGCAGAGGG - Intergenic
917105688 1:171489360-171489382 CCCAGTGAATCAGAGCAATATGG + Intronic
917489297 1:175483993-175484015 CACAGTGCAGCGGGGGCATATGG - Intronic
917716195 1:177740375-177740397 TACAGTGCATAAGATGCATATGG - Intergenic
919418805 1:197345432-197345454 CAAAGTGAATCAGAGTCAAAAGG + Intronic
924897847 1:248361808-248361830 CACAGTGTATCAGAAGGATCAGG - Exonic
924908971 1:248488732-248488754 CACAGTGTATCAGAAGGATCAGG - Exonic
924915134 1:248559326-248559348 CACAGTGTATCAGAAGGATCAGG + Exonic
1064839385 10:19573444-19573466 CCCAGTGGAGCAGAGACATGAGG + Intronic
1065528192 10:26643401-26643423 CACAGAGGAGCAGAGGCACCCGG + Intergenic
1067397588 10:45936621-45936643 CACAGTGGACCAGAAGAAAAGGG + Intergenic
1067845950 10:49721455-49721477 CACGGTGGGTCAGGGGCAGAGGG + Intergenic
1067865905 10:49905714-49905736 CACAGTGGACCAGAAGAAAAGGG + Intronic
1068891913 10:62156700-62156722 CACATTTGAACAGAGGGATAGGG + Intergenic
1070284163 10:75071452-75071474 CACAGTAGATGAGGGGCTTAGGG - Intergenic
1071292902 10:84200530-84200552 CTCAGGGGGACAGAGGCATAGGG - Intronic
1072861459 10:99009541-99009563 AACAGTGGACCAGAGGGAAAAGG + Intronic
1073137575 10:101228403-101228425 CAGAGGCGAGCAGAGGCATAGGG + Intronic
1073540765 10:104314989-104315011 CACACTGGATCACAGGAATCAGG + Exonic
1076307510 10:129475385-129475407 CACAGTGCATGAGAGGCGTGAGG + Intronic
1077086212 11:752701-752723 CACAGAGGAAGAGATGCATAGGG - Intronic
1081562148 11:44227548-44227570 GAAAGTGGACCAGAGGCACATGG - Intronic
1089074489 11:115727374-115727396 CACAGGGGACCAGAGGGATATGG + Intergenic
1093002455 12:14013114-14013136 CACAGTTGTTAAGAGGCCTAGGG + Intergenic
1093560118 12:20528412-20528434 CACTTTGAATCAGAGGCACAAGG + Intronic
1094188918 12:27676939-27676961 CACCGTGGAGGAGAGGCATGCGG - Intronic
1097162442 12:57057493-57057515 CACAGAGGATCTGAAGCATCTGG + Exonic
1098657272 12:73048211-73048233 CACAGTGGTTCAGAGCCCGAAGG - Intergenic
1101026792 12:100615855-100615877 GACAGTGTATCACTGGCATAGGG - Intronic
1103865617 12:124049618-124049640 CACAGTGAATAAGATGCATGTGG - Intronic
1105947006 13:25198602-25198624 CACATTGGATGGGAGGCAGAGGG - Intergenic
1107248818 13:38331890-38331912 GACAGTGTATCACTGGCATAGGG + Intergenic
1108347099 13:49557017-49557039 AACAGTGGATCTGGGGCATGAGG + Intronic
1110671846 13:78189741-78189763 TTCAGTGTATCAGTGGCATAGGG + Intergenic
1112629746 13:101147831-101147853 CACAGAGGTTCTGAGGCAGAGGG - Intronic
1114771456 14:25431751-25431773 CACAGTGGGTCAAATGCATGGGG - Intergenic
1122045165 14:99017774-99017796 AACAGTGGATCGGGGGCACAGGG + Intergenic
1123774452 15:23565456-23565478 CACAGCGAAGCAGAGGCAGAAGG + Intergenic
1124105776 15:26736665-26736687 GACAGTGGATCTGGAGCATAGGG + Intronic
1125521093 15:40348247-40348269 CACAGTGATTCAGAGGCAGTTGG - Intergenic
1125776711 15:42222442-42222464 CACAGTTTATCAGAAGCCTAGGG + Intronic
1129472626 15:75763925-75763947 TACAGTGGATCAGAGCCACTGGG + Intergenic
1129607389 15:77031521-77031543 CTCTGTGGCTCTGAGGCATAAGG - Intronic
1131944090 15:97600103-97600125 CCCAGTTGATCAGTGGCCTATGG + Intergenic
1136122511 16:28148112-28148134 CACAGCTCATCAGATGCATATGG + Intronic
1137313058 16:47285860-47285882 CACAGATGATCAGAGGCAGAGGG - Intronic
1137568959 16:49552243-49552265 CACAGTGAGTCAGTGGCAGAGGG - Intronic
1138053272 16:53805369-53805391 CACAGTAAAGCAGAGGCTTAGGG + Intronic
1141462218 16:84184297-84184319 GACAGTGGAGCAGAGGCTTGGGG - Intronic
1143387364 17:6539192-6539214 GACAGGGGATCAGAAGCTTAGGG - Intronic
1145270189 17:21400670-21400692 CACGCTGGATCAGAGGGAGAAGG - Intronic
1147725410 17:42563686-42563708 CAGAGGGCATCAGAGGCAGATGG - Intronic
1150976350 17:70091419-70091441 CACAGTGCAGGAGAGGCCTATGG + Intronic
1152457328 17:80423868-80423890 CACGGTGGCTCAGAGGCAAGGGG - Intronic
1153989923 18:10387305-10387327 CACAGTGGTGCAGAGCCCTAAGG - Intergenic
1156479028 18:37424655-37424677 CACACAGGATCAGAGGCCGAGGG + Intronic
1164874368 19:31672861-31672883 CAAAATAGATTAGAGGCATAAGG - Intergenic
1166406293 19:42524409-42524431 ACCAGGGGATCAGAGGCAGAAGG - Intronic
1167146737 19:47685358-47685380 CACAGAGGCTCGGAGGCACAAGG + Intronic
1168143177 19:54403206-54403228 CACGAGGGATCAGAGGCAGAGGG - Intergenic
929763982 2:44829111-44829133 AACAGTGGTGGAGAGGCATACGG - Intergenic
931400152 2:61924411-61924433 TAGAGTGGAGCAGAGGCATATGG + Intronic
937042325 2:118832362-118832384 CTCAGTGGCTAAGAGGGATAGGG - Intergenic
939690635 2:145255778-145255800 CAAAGAGGATCAGAGACATGTGG + Intergenic
940119771 2:150251307-150251329 CACAGTATATTACAGGCATAAGG - Intergenic
940454434 2:153878350-153878372 CACAGTGGTTCAGAGTAAGATGG - Intronic
941719441 2:168797814-168797836 CACAGGGCAACAGAGGCACAAGG - Intronic
943446561 2:187994449-187994471 CACCGTGCTTCAGGGGCATAAGG + Intergenic
946068104 2:217007527-217007549 CACAGTGATACAGAGGCACAGGG - Intergenic
946299102 2:218811637-218811659 CTCAGTGGGTCAGAGGGACAGGG - Intronic
947693544 2:232162455-232162477 CACAGTGGTAAAGAGGAATAGGG - Intronic
948735054 2:239998187-239998209 CAAAGTGGATGAGAGGCCAAAGG - Intronic
1174135896 20:48378996-48379018 CACAGTGAAAGAGAGGCATGGGG - Intergenic
1175259090 20:57663683-57663705 CAGAGTGGAGCACAGGCAGAGGG + Intronic
1175451672 20:59074163-59074185 CACATTAGATAAGATGCATATGG - Intergenic
1176240787 20:64074976-64074998 CCCAGGGGAGCAGAGGCAGAAGG - Intronic
1176241233 20:64076821-64076843 CCCAGGGGAGCAGAGGCAGAGGG + Intronic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1178602939 21:34010655-34010677 AACAGTGGATGTGAGGCCTATGG - Intergenic
1179526291 21:41978084-41978106 CACACTGGATCATAGGCAAAAGG + Intergenic
1181829504 22:25548528-25548550 CAAACTTGATCAGAGGCAGATGG - Intergenic
1184116516 22:42425859-42425881 CACAGGCGCTCAGAGGCATGTGG - Intronic
949387016 3:3514206-3514228 CACACTGAATCAGAGGCAGTGGG + Intergenic
950788494 3:15454500-15454522 CACTGTGCACCAGAGGCAGAAGG + Intronic
952825329 3:37519996-37520018 CCCAGTGGGTCAGAGACAGAAGG + Intronic
953183819 3:40620157-40620179 TAAAGGGGATCAGAGGCAAAAGG - Intergenic
953655932 3:44854739-44854761 CACAGTCTCTCAGAGCCATAGGG + Intronic
961176306 3:124837944-124837966 AACAGTGGAACAGAGGGAGAAGG - Intronic
961998373 3:131269906-131269928 CACAGTGGAACACAGGCTCAAGG + Intronic
962693157 3:137921551-137921573 CACAGTGGCAAAGAGGCAAATGG - Intergenic
964011398 3:151896715-151896737 GACAGTGACTCACAGGCATAAGG + Intergenic
966344519 3:178963797-178963819 GAAAGAGGATCAGAGGCCTAAGG - Intergenic
968929026 4:3566282-3566304 CACAGGGAACCAGAGGCAAAGGG - Intergenic
969101027 4:4768443-4768465 CAGTGTGGATCAGAGGACTAGGG + Intergenic
970123754 4:12786655-12786677 AACAGCGGATCAAAGGTATATGG - Intergenic
972314248 4:37911231-37911253 TGCAGTGGATCAGAGCCATGTGG + Intronic
972758565 4:42077883-42077905 CAAAGTGGATGAAAGACATAAGG - Intronic
973269776 4:48250779-48250801 CACAGTGGACCACAGACACATGG + Intronic
992138660 5:73773194-73773216 CACAGTGGAGCTGATGCACACGG + Intronic
992326478 5:75665088-75665110 TTCAGTGGTTCAGAGGCAAATGG + Intronic
994136245 5:96290565-96290587 GACAGGGCATCAGATGCATAGGG - Intergenic
995902712 5:117089125-117089147 CACAGTGGCACACAGGCATGAGG - Intergenic
997411290 5:133692891-133692913 CACAGTGCAGCAGAGGCAGATGG - Intergenic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1003735445 6:8873079-8873101 CACAGAGGATGAGAAGCAAAAGG - Intergenic
1008638212 6:53433585-53433607 CACAGTGGGAGAGAGGAATATGG - Intergenic
1010084934 6:71905997-71906019 CACACTGGAGTACAGGCATAAGG - Intronic
1013224052 6:108106890-108106912 CAGAGTGCATCAGAGGAAAAGGG + Intronic
1016792367 6:148079205-148079227 GACAGAGGATCAGAGGCAGAAGG - Intergenic
1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG + Intronic
1026582333 7:71628964-71628986 AACAGTGGTTCAGATGCAAATGG - Intronic
1029319281 7:99743246-99743268 CACAGGGGAACAGAACCATAAGG + Intergenic
1032844014 7:135737247-135737269 CAAGGTGGATCAGAGGGAGAAGG - Intronic
1034858896 7:154579701-154579723 CAGAGAGGAACAGAGGCAGATGG + Intronic
1034941827 7:155235722-155235744 CACAGTGGAACAGAGGGCTAAGG + Intergenic
1037396738 8:18451349-18451371 CACAGTTGTTGAGAGGCACAGGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1043397655 8:79854437-79854459 CAAAGTGGAAAAGAGGTATAGGG - Intergenic
1046031201 8:108785815-108785837 CACAGTGAATAAGCAGCATATGG - Intronic
1046354422 8:113061174-113061196 CACAATAGATCAGAGAAATATGG - Intronic
1054754475 9:68943434-68943456 CACAGTGGGTCAGGGAAATAGGG - Intronic
1056387683 9:86112562-86112584 CACAGTGAATCAGGGGCCAAGGG + Intergenic
1056909164 9:90682503-90682525 CACAGAGGATCCCAGGCAGATGG + Intergenic
1057543103 9:95994331-95994353 CTCAGTGGGTCAGAGCCATCAGG + Intronic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1061433803 9:130547929-130547951 CACACTGGGACAGAGGCAGAAGG + Intergenic
1062550685 9:137085004-137085026 CTCAGTGGGTCACAGGCATGTGG + Intergenic
1185513984 X:684813-684835 CAGAGTGGAACAGAGCCAGAGGG - Intergenic
1187013529 X:15303846-15303868 CACAGTAGAGCAGTGCCATAAGG + Intronic
1187592177 X:20729706-20729728 TACAGTGGAACAAAGCCATAAGG + Intergenic
1193928230 X:87517732-87517754 CACAGTGTATCATAGGCAGTGGG + Intronic
1195598746 X:106722510-106722532 CACAGTGAAATAGAGGAATACGG + Intronic
1195684005 X:107569585-107569607 CACAGTGCATCAGAGCCAGCTGG + Intronic
1196121329 X:112054188-112054210 CAAGGTGGAGCAGAGGAATATGG + Intronic
1200302595 X:154993022-154993044 CACAGTGGGTCAGAGGCCATTGG + Exonic
1200919017 Y:8596578-8596600 GCCAGTGTATCATAGGCATATGG + Intergenic