ID: 1026383539

View in Genome Browser
Species Human (GRCh38)
Location 7:69822919-69822941
Sequence TGGGGACCTCGGCAGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026383539_1026383547 21 Left 1026383539 7:69822919-69822941 CCCACTTACTGCCGAGGTCCCCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1026383547 7:69822963-69822985 AAATCTAAAATGGAAAACTAGGG No data
1026383539_1026383546 20 Left 1026383539 7:69822919-69822941 CCCACTTACTGCCGAGGTCCCCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1026383546 7:69822962-69822984 TAAATCTAAAATGGAAAACTAGG No data
1026383539_1026383545 11 Left 1026383539 7:69822919-69822941 CCCACTTACTGCCGAGGTCCCCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1026383545 7:69822953-69822975 TGACAAAAATAAATCTAAAATGG 0: 1
1: 0
2: 14
3: 157
4: 1489
1026383539_1026383548 27 Left 1026383539 7:69822919-69822941 CCCACTTACTGCCGAGGTCCCCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1026383548 7:69822969-69822991 AAAATGGAAAACTAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026383539 Original CRISPR TGGGGACCTCGGCAGTAAGT GGG (reversed) Intronic
904818688 1:33225909-33225931 TGGGGAACACTGCAGTAAATGGG - Intergenic
913112327 1:115667535-115667557 TGGGGACCTCAACTGTAAGAGGG - Intronic
923460645 1:234206633-234206655 TGGGGACCTTGGTAGTAAACAGG - Intronic
1064850534 10:19704480-19704502 TGGGGCCCTTGGAAGTAATTTGG - Intronic
1069888198 10:71637077-71637099 AGGGGACCTCGGCAGGAGGTAGG - Intronic
1070679446 10:78438345-78438367 TGGGGACCTCATCTGTAAATGGG + Intergenic
1073292365 10:102419573-102419595 TGGTGACCTCGGAAGGAAGAAGG + Intronic
1073930171 10:108566539-108566561 CGGGGCCCTGGGCAGGAAGTGGG + Intergenic
1076533188 10:131159118-131159140 TGGGGGCCTCGGCAGGAAAAGGG + Intronic
1078637634 11:13066562-13066584 TGGGGATCTCGGCAGACAGTGGG + Intergenic
1084044614 11:66561443-66561465 TGGGAACCCCTGCAGGAAGTGGG + Exonic
1084859489 11:72008981-72009003 TGCGCACCTGGGCAGTAAGGTGG + Exonic
1086375053 11:86191568-86191590 CGGGGACCTCAGCAGCAAGCAGG + Intergenic
1090173752 11:124628580-124628602 TGTGGGCCTCATCAGTAAGTGGG + Intronic
1091750329 12:3018216-3018238 TGGGACCCTTGGCATTAAGTGGG + Intronic
1094284606 12:28779134-28779156 TTGGAATCTAGGCAGTAAGTAGG - Intergenic
1095654157 12:44649525-44649547 TGGGGACCACTGCAGGATGTGGG - Intronic
1101451882 12:104787239-104787261 TGAGGAACTCGGCAGGGAGTTGG + Intergenic
1117217457 14:53566572-53566594 TGTGGAACTTTGCAGTAAGTGGG + Intergenic
1119264904 14:73258965-73258987 TGGGGACCTCTGCAGGGAGCCGG - Exonic
1124377083 15:29135170-29135192 TGGGGAACACAGCAGTGAGTTGG - Intronic
1133524584 16:6592246-6592268 TGTGGTACTAGGCAGTAAGTTGG + Intronic
1138227596 16:55310811-55310833 TGGGGACTTCAAAAGTAAGTAGG - Intergenic
1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG + Intergenic
1140480618 16:75261110-75261132 TGGGGACCTCGGCAGAAGTGTGG - Intronic
1144620165 17:16813578-16813600 GGGGGACCTCTGCAGTTGGTTGG + Intergenic
1144892521 17:18502124-18502146 GGGGGACCTCTGCAGTTGGTTGG - Intergenic
1145796171 17:27656515-27656537 GGGGGACCTCTGCAGTTGGTTGG - Intergenic
1145810620 17:27761838-27761860 GGGGGACCTCTGCAGTTGGTTGG - Intronic
1145888412 17:28398199-28398221 TGGGGACCTCAGGAGGGAGTGGG - Exonic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148063234 17:44850779-44850801 TGGGGACCCAGGCAGGAAGGAGG + Exonic
1152120831 17:78417353-78417375 TTGGGACCTCAGCAGCAATTAGG + Intronic
1158937505 18:62377954-62377976 CGGGGACCTCTGCAGTTAGCAGG - Intronic
1162566538 19:11448039-11448061 TGGGAGCCTGGGCAGCAAGTCGG + Intronic
1165996463 19:39847243-39847265 TGAGGACTTAGGCAGTAAGATGG + Intergenic
1166546249 19:43636166-43636188 TGGGGACCTAGGCATCAGGTGGG + Intronic
927732749 2:25488999-25489021 TGGGGACCTATGCAGTAAGAGGG + Intronic
932444124 2:71762989-71763011 TGGTGACCACGGCTCTAAGTTGG + Intergenic
938103490 2:128513930-128513952 GGGGGACCCAGGCAATAAGTAGG - Intergenic
945035218 2:205698563-205698585 TAGGGACCTCGGTAGTAACATGG - Intronic
948888921 2:240897450-240897472 TGGGGACCTAGGCAGGCCGTGGG - Intergenic
949055824 2:241927871-241927893 TGGGTACCTCTGCTGTGAGTGGG - Intergenic
949055974 2:241928434-241928456 TGGGTACCTCTGCTGTGAGTGGG - Intergenic
1176004155 20:62850682-62850704 TGGGGGCCTCGGCAGTCTTTGGG - Intronic
1179279704 21:39924167-39924189 AGGGGACGTGGGCAGTAAGGTGG - Intronic
1179501942 21:41815574-41815596 TGGGGAACCCGGCACTCAGTGGG + Intronic
1180621702 22:17166920-17166942 TGGGGTCCTGGTCAGTAAGCTGG + Intergenic
950582938 3:13874483-13874505 TGGGGACTGCGGCAGTGAATGGG + Intronic
951591017 3:24264861-24264883 TGGGGCCCTCTGCTGTAAGGAGG - Intronic
952314217 3:32218546-32218568 TGGGGGCCTCAGCAGGAAATTGG + Intergenic
953372230 3:42398308-42398330 TGGGAACCTCAGCAATAAGAAGG + Intronic
956773943 3:72549721-72549743 GGGGGACCTCTGCAGTGAGATGG + Intergenic
961601688 3:128067138-128067160 TGGGCACCTGGTCGGTAAGTAGG + Exonic
968486484 4:865528-865550 TGGGGATGGCGGCAGAAAGTGGG - Intronic
968548018 4:1208380-1208402 CGGGGGCCTTGGCAGGAAGTTGG - Intronic
970929810 4:21496616-21496638 TGGGGACCCCTGCTGTAGGTAGG - Intronic
980919711 4:139071042-139071064 TGAGGAAATGGGCAGTAAGTGGG - Intronic
982404567 4:155005652-155005674 TGGGGACTTTGGCAGTGACTCGG - Intergenic
985820179 5:2154259-2154281 GAGGGACCCCGGCAGTAGGTAGG + Intergenic
995158584 5:108946209-108946231 TGGGCTCTTCAGCAGTAAGTAGG + Exonic
996017834 5:118560609-118560631 TGGGGACCTCAGAAGTCACTGGG + Intergenic
1000130291 5:158290637-158290659 TGGGGAGCTCAGCAGTAAGCTGG + Intergenic
1003609395 6:7595891-7595913 TGGGAACCTCAGCAGAGAGTAGG + Intronic
1005348287 6:24910956-24910978 AGGGGACCCCGGGAGGAAGTCGG + Intronic
1007249544 6:40486438-40486460 TGGGGAATTCGGCAGTTAGTGGG + Intronic
1011787557 6:90864056-90864078 TGGGCACCCCGGGAGTGAGTTGG + Intergenic
1018901132 6:168052337-168052359 TGGGGGCCTCTGCAGGAGGTGGG - Intergenic
1021224849 7:18014832-18014854 TGGGGACCTCAGCAGGGAGCTGG + Intergenic
1024878572 7:54056872-54056894 TGGGGACCCCAGTAGGAAGTAGG - Intergenic
1026383539 7:69822919-69822941 TGGGGACCTCGGCAGTAAGTGGG - Intronic
1027186170 7:75972041-75972063 TGGGGACCTGGGCTGTGGGTGGG + Intronic
1029570580 7:101365935-101365957 TGGGGACATCTGCAGAAACTTGG + Intronic
1033416626 7:141167383-141167405 TGGGGCCCTCAGTAGCAAGTTGG + Intronic
1035306354 7:157935494-157935516 TGGGAACCTCAGCAGAAAGATGG - Intronic
1042236578 8:66619234-66619256 TGAGGACCTCGGGAGAAAATGGG - Intergenic
1053272507 9:36760131-36760153 TGGCGACCTCGGCAGGCACTGGG + Intergenic
1057359925 9:94364089-94364111 TGGGGAACTCAGCAGCAACTAGG - Intergenic
1057663415 9:97024000-97024022 TGGGGAACTCAGCAGCAACTAGG + Intergenic
1059379557 9:113912539-113912561 GGGGGAACTCAGGAGTAAGTCGG + Intronic
1197915890 X:131534620-131534642 TGGGGAACTTGGGAGAAAGTAGG + Intergenic