ID: 1026385390

View in Genome Browser
Species Human (GRCh38)
Location 7:69842323-69842345
Sequence ATAATTAGGACAAGTTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026385390_1026385392 7 Left 1026385390 7:69842323-69842345 CCAGATAAACTTGTCCTAATTAT 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1026385392 7:69842353-69842375 CTCTTTAAAGCACATACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026385390 Original CRISPR ATAATTAGGACAAGTTTATC TGG (reversed) Intronic
906085753 1:43132387-43132409 ATAATTAGAACAAATTTCACTGG + Intergenic
907902593 1:58754690-58754712 ATCACTTTGACAAGTTTATCAGG - Intergenic
909644640 1:77903452-77903474 ATAATTTGAAAATGTTTATCAGG + Intronic
909754360 1:79204885-79204907 ATAATTAGGACCAGATCATGAGG + Intergenic
910043057 1:82877002-82877024 ATAATAATGACAAGTATATAAGG - Intergenic
910686097 1:89918119-89918141 AAAATTCGGACAATTTTATACGG - Intronic
915403139 1:155638707-155638729 ATAATTAAAACAACTTTACCAGG - Intergenic
916385159 1:164258903-164258925 ATAATTAAGAAAAATTTCTCTGG - Intergenic
917693538 1:177494173-177494195 ATAATTAAGTCAAGTCTATGTGG + Intergenic
918884213 1:190169706-190169728 ATAATAATGACAACTTTATCAGG + Intronic
921387343 1:214583602-214583624 AAAATTAACACAAGTTAATCAGG - Intergenic
922332402 1:224588833-224588855 ATAATAAGGACCAGCTTCTCAGG + Intronic
923115896 1:230937491-230937513 ATAAACTGGACAAGTCTATCTGG + Intronic
924007667 1:239629858-239629880 ATAATTAGGACAGCATTCTCTGG + Intronic
1063925006 10:10969049-10969071 ATGATTATGACAAGAGTATCTGG + Intergenic
1066063003 10:31740696-31740718 ATATTAAGCACAATTTTATCTGG + Intergenic
1067219191 10:44330907-44330929 ATAAATAATAAAAGTTTATCTGG + Intergenic
1068295334 10:55063759-55063781 ATAATTTGGACAGCTTTATGGGG - Intronic
1068832443 10:61511897-61511919 AAAATTAGGGCAAGTATATATGG + Intergenic
1069365982 10:67693044-67693066 AAGATTAGGTCAAGTTTATTTGG - Intronic
1069555849 10:69397771-69397793 ATAAATAAGACAAATATATCAGG + Intronic
1070275336 10:75000588-75000610 ATATTAATGGCAAGTTTATCTGG - Intronic
1076728749 10:132427163-132427185 TTAATTAGGAGAAGTTGATTAGG + Intergenic
1077930493 11:6726771-6726793 ATAAAGAAGACAAGTTTATTTGG + Intergenic
1079537627 11:21533897-21533919 ATAATTATGACAAGTCTCTGGGG + Intronic
1079751338 11:24202482-24202504 ATAATTGGAACAAGTTTATGTGG + Intergenic
1081073464 11:38639720-38639742 TTAATTAAGATAACTTTATCTGG + Intergenic
1081112075 11:39148856-39148878 ATAATTAGCATAACTTTATAAGG + Intergenic
1085490455 11:76911709-76911731 ATATTTAGGCCAAGTATATAAGG - Intronic
1086236418 11:84636625-84636647 ATAATGAGTAGAAGTTTGTCAGG - Intronic
1088173421 11:107021833-107021855 TTAACTAGGGCAAGTTTTTCTGG + Intergenic
1091160640 11:133416517-133416539 AGGATTAGGAGCAGTTTATCAGG - Intronic
1094669285 12:32553274-32553296 GGAATTAGGACAAGTATAGCAGG + Intronic
1095736141 12:45558502-45558524 TTAAGTAGGAGAAATTTATCTGG + Intergenic
1097435147 12:59546019-59546041 ATAATTAGGAATAATATATCAGG - Intergenic
1100852095 12:98722843-98722865 GTAATTAGGATAATTTTCTCAGG + Intronic
1101140526 12:101791126-101791148 ATTATGAGGACAAGATGATCAGG - Intronic
1107538318 13:41358569-41358591 ATTATTAGAAAAAGATTATCAGG - Intronic
1111503866 13:89161079-89161101 ATAATTTAGAAAAGTTTATGAGG + Intergenic
1112859303 13:103810504-103810526 AGAAATAGGACAACTTTTTCTGG - Intergenic
1113268967 13:108651599-108651621 ATTATTTGGGCATGTTTATCTGG - Intronic
1115947923 14:38684464-38684486 ATAAATCGTACAAGTTTGTCTGG - Intergenic
1116215650 14:42013935-42013957 ATAACTAGGACTAGTACATCAGG - Intergenic
1116218178 14:42047712-42047734 ATAATTAGGATGAGGTTACCTGG - Intergenic
1116942516 14:50804557-50804579 ATAATTTGGACAAGTCTTCCGGG - Intronic
1120267174 14:82265849-82265871 ATTGTTAGGATAAGCTTATCTGG + Intergenic
1124321414 15:28714678-28714700 AAAATTAGGAAAATTTCATCAGG + Intronic
1124522507 15:30416495-30416517 AAAATTAGGAAAATTTCATCAGG + Intergenic
1124536157 15:30549719-30549741 AAAATTAGGAAAATTTCATCAGG - Intergenic
1124762495 15:32457872-32457894 AAAATTAGGAAAATTTCATCAGG + Intergenic
1124776133 15:32591199-32591221 AAAATTAGGAAAATTTCATCAGG - Intergenic
1124963694 15:34417571-34417593 AAAATTAGGAAAATTTCATCAGG - Intronic
1124980315 15:34563797-34563819 AAAATTAGGAAAATTTCATCAGG - Intronic
1127324282 15:57880286-57880308 ATATTTAGGACAAGTCTCACGGG - Intergenic
1127573062 15:60262899-60262921 ATAATTAAAAAAAGTTTAGCTGG - Intergenic
1130265277 15:82395844-82395866 AAAATTAGGAAAATTTCATCAGG - Intergenic
1130383363 15:83391065-83391087 AGGATTAGGATGAGTTTATCAGG + Intergenic
1131865970 15:96710374-96710396 ATATTCAGAACAAGTTTATGAGG - Intergenic
1135905047 16:26504243-26504265 TTAATTAGGACCATTTTATCTGG - Intergenic
1136040111 16:27571937-27571959 ATTGTTAGGCCAATTTTATCAGG - Intronic
1138560205 16:57796915-57796937 ATACTTAGGACAACCTTATGGGG + Intronic
1139154634 16:64425670-64425692 ATACATAGGACAACTTTATAGGG + Intergenic
1142788869 17:2247437-2247459 ATAAATAGAACCAGTTTATAAGG - Intronic
1145046798 17:19624634-19624656 ATAATTCTGAAAACTTTATCTGG - Intergenic
1148635253 17:49144204-49144226 GTAATTAGGATAAGGTCATCAGG - Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1153155156 18:2140634-2140656 ATAATTACGACAAGCTTCACAGG - Intergenic
1155092092 18:22521955-22521977 ATTATTAGGACAATTTAATAAGG - Intergenic
1155846016 18:30707768-30707790 ATGATTAAGAGAAGTTTATCTGG + Intergenic
1156209525 18:34924377-34924399 ATAAACAGGAGAAGTTTATTTGG + Intergenic
1156832644 18:41513323-41513345 ATACTTTGGATAAGTATATCAGG + Intergenic
1157049748 18:44148965-44148987 ATAATTAGATAAAGTTCATCTGG - Intergenic
1157458350 18:47859115-47859137 ATAATTAGGGCAAATTAATTTGG + Intronic
1158784141 18:60688727-60688749 ATAATTAAGATAATTTTATAAGG - Intergenic
1159857853 18:73610690-73610712 AAAATTATCACAAGATTATCTGG + Intergenic
1161881383 19:6956158-6956180 AAAATTAGGACAAATTTTCCTGG - Intergenic
1164216965 19:23159024-23159046 TAAATTAGGACAATTTAATCTGG - Intergenic
1168070076 19:53944420-53944442 ATAATAAAACCAAGTTTATCTGG + Intergenic
926564885 2:14457747-14457769 ATAATTGGGACCTGTCTATCTGG - Intergenic
928070797 2:28213567-28213589 ATAATTAGTAGAAGTTAATTAGG - Intronic
929911402 2:46092600-46092622 ATAGTTAAGACAGGTTTATAAGG - Intronic
930648876 2:53944035-53944057 ATACTTAGTTCAAGTTGATCAGG - Intronic
930922251 2:56770239-56770261 AGTATTAGGTCAATTTTATCAGG + Intergenic
930977040 2:57476735-57476757 ATATTTAGATCATGTTTATCAGG + Intergenic
932574484 2:72955226-72955248 CTAATTAGGAGCAGTTTAACAGG - Intronic
933517226 2:83320127-83320149 ATATTTAGGATAAGCTTATTAGG - Intergenic
936063343 2:109312328-109312350 ATAATTCTAACAAGTTTAACGGG + Intronic
936789399 2:116133228-116133250 ATAACAAGAACAAGTTTAACTGG + Intergenic
938816145 2:134906198-134906220 ATACTTTGGACATTTTTATCTGG - Intergenic
940294353 2:152106818-152106840 TTAATTATGACAAATTTACCAGG + Intergenic
941015194 2:160348066-160348088 ACAATTAGGAAAACTTTTTCCGG - Intronic
943595660 2:189852501-189852523 ATACTTAAGACATGATTATCAGG + Intronic
943800857 2:192056091-192056113 AAAATTAAGACAAGATTATGTGG - Intronic
944281993 2:197908669-197908691 ATGATTAGGAAATGCTTATCGGG - Intronic
945527037 2:210901176-210901198 ATAATTAGGACTAAGTTCTCTGG - Intergenic
945675837 2:212854774-212854796 ATAATTATGGTAAGTTTATTTGG + Intergenic
946613506 2:221484093-221484115 GAAATTAGTACAAGTTTCTCAGG + Intronic
1169563233 20:6824840-6824862 ATAATGAGAAGAAGTTTATTTGG + Intergenic
1170002493 20:11630599-11630621 ATTTTTAGGACATGTTTTTCAGG - Intergenic
1173365137 20:42378243-42378265 ATATTTAAGAGATGTTTATCTGG - Intronic
1174891008 20:54393023-54393045 ATAATTAGAACAAGTAAATTAGG - Intergenic
1174959809 20:55142945-55142967 CTAATTATGCCAAGTTTATCAGG + Intergenic
1177961576 21:27673354-27673376 ATAATTAGAACCAGAGTATCTGG + Intergenic
1178213604 21:30567893-30567915 TTAATTATCCCAAGTTTATCAGG - Intergenic
952569677 3:34699810-34699832 ATAATTAGGAAAAATTTAACAGG + Intergenic
953076463 3:39575296-39575318 AGAAATAGGTCAAGTTTAACAGG + Intergenic
955331663 3:58052251-58052273 ATAATTAGGAAAAATTAATCAGG + Intronic
956053465 3:65274304-65274326 TTAATTACTACAAGTTTGTCTGG - Intergenic
957833762 3:85558039-85558061 ATAATTAGGACTGGTTTTACAGG - Intronic
962073881 3:132059992-132060014 ATAATTAGGTCAGGTTTTTTTGG + Intronic
963907830 3:150787908-150787930 AGAATTTTGACAAGCTTATCTGG + Intergenic
965386387 3:168051090-168051112 ATAATTATGACCTGATTATCTGG - Intronic
965569111 3:170153427-170153449 ATAATCAGGGAAAGATTATCTGG - Intronic
971844721 4:31904862-31904884 ATAAGAAGAACAAGCTTATCAGG - Intergenic
974426927 4:61753777-61753799 ATAATGAGGAAAAGTTTAATGGG - Intronic
974574791 4:63704252-63704274 ATAATTTGGACAAAAATATCTGG - Intergenic
976834703 4:89358148-89358170 ATAATTCGGAGGAGTTAATCTGG - Intergenic
978994816 4:115137866-115137888 ATAGTTTTGACAAGTTTTTCTGG + Intergenic
979164170 4:117505182-117505204 ATAATTAAGACAAACTTATCAGG - Intergenic
980628073 4:135400441-135400463 TTTATTAGAACTAGTTTATCAGG - Intergenic
981632393 4:146835420-146835442 ATATTTAGGAAAAGATTTTCTGG + Intronic
982188723 4:152831145-152831167 AAAATTAGTAAAAGTTTATCAGG - Intronic
983710464 4:170709513-170709535 ATCTTTAGGACATGTGTATCTGG - Intergenic
984389602 4:179111803-179111825 ATAATTAGGAGAAATCTATGAGG + Intergenic
987342747 5:16953138-16953160 ATGACTAGGACAAGTTTCACTGG + Intergenic
987775857 5:22364815-22364837 AGAATTTGAACATGTTTATCTGG + Intronic
988893764 5:35649487-35649509 ATATTTAGAAATAGTTTATCTGG + Intronic
989262672 5:39435917-39435939 ATAAGTTGGACAAGTTTAGCTGG - Intronic
990002703 5:50913027-50913049 ATAAATAAGAAAAGTTTATTTGG - Intergenic
990694149 5:58396284-58396306 TGAATAAGGACAAGCTTATCTGG - Intergenic
993051160 5:82927667-82927689 AAAATTAAGAGAAGCTTATCTGG - Intergenic
994189964 5:96858527-96858549 GTAATTAGTTCAAGGTTATCGGG - Intronic
997607738 5:135187251-135187273 ATAATTAGAAGAATCTTATCGGG - Intronic
997607765 5:135187559-135187581 TTAATAAGGACAAGTTTTTATGG - Intronic
1000384920 5:160666132-160666154 ATTATTAGGATAAGTGTTTCTGG + Intronic
1000709603 5:164555497-164555519 ATAATTAGAACAGATTTTTCAGG - Intergenic
1004375690 6:15088909-15088931 AACATTAGAACAAGTGTATCTGG - Intergenic
1007380422 6:41486868-41486890 ACAATTAGGAAAAGGTAATCGGG + Intergenic
1007841450 6:44719356-44719378 AGATTTAGGACAACTTTCTCAGG + Intergenic
1010191873 6:73204175-73204197 ATGCATAGGGCAAGTTTATCAGG + Intergenic
1010794016 6:80098410-80098432 AAAATTTGAACAAGTTTCTCAGG + Intergenic
1013384941 6:109618079-109618101 ATAATTAGGAAAAGGATATTTGG + Intronic
1014020195 6:116578125-116578147 ATAATTTGTCCAAGGTTATCAGG - Intronic
1014357352 6:120429316-120429338 AAAATTAGGAAAATTTTCTCTGG + Intergenic
1014712587 6:124824615-124824637 ATAATTAGCTCAGGCTTATCAGG + Exonic
1014975798 6:127880791-127880813 CTTATTAGGACAAGTTTTTTGGG - Intronic
1015594592 6:134854194-134854216 ATAATTTGTACATGTTTATGGGG + Intergenic
1016394530 6:143608934-143608956 ATAATTAGCATAAAATTATCAGG + Intronic
1023548996 7:41348739-41348761 GAGATTAGGACAAGTTTATACGG - Intergenic
1026385390 7:69842323-69842345 ATAATTAGGACAAGTTTATCTGG - Intronic
1027504780 7:79002590-79002612 ATAATTATGAAAAGTATATCTGG + Intronic
1029357816 7:100065767-100065789 ATAATTGGGATATGTTTAGCAGG - Intronic
1031615976 7:123880002-123880024 AAAATTAGAACAAGTATATTTGG - Intergenic
1032313812 7:130815188-130815210 ATAATTAGAACAAGAGTAGCAGG + Intergenic
1033016101 7:137673135-137673157 TTAATTAGGATGAGTTCATCTGG - Intronic
1034004408 7:147453226-147453248 ACAATGAGGAGAAGTTTACCAGG - Intronic
1034868156 7:154658373-154658395 ATAAATAAGAAAAGTTTACCAGG + Intronic
1041120140 8:54578138-54578160 ATAATTAGAAAATGTTTGTCAGG - Intergenic
1042786944 8:72558473-72558495 ATAATGAGTAAAAGTTTATTAGG + Intronic
1043132397 8:76477557-76477579 AAAATTAGGTCAAGTTTACCTGG - Intergenic
1043343508 8:79271023-79271045 ATAATTAGGAAAAGGTGATCAGG - Intergenic
1044747320 8:95383312-95383334 ATATTTAAGACAACTTTATGAGG + Intergenic
1045263024 8:100593752-100593774 AGACTTAGGATAAGGTTATCAGG - Intronic
1045831864 8:106471291-106471313 ATAATTAGCAATAATTTATCTGG + Intronic
1045985033 8:108239939-108239961 AAAATTAAGACGAGTTTACCTGG + Exonic
1046633518 8:116646017-116646039 ATAACCAGAAAAAGTTTATCCGG + Intronic
1047642553 8:126835889-126835911 TTCATAAGGACAAGTTGATCAGG - Intergenic
1048514207 8:135091068-135091090 ATAACTAGGTGGAGTTTATCTGG - Intergenic
1049921734 9:370839-370861 TTAATTAGGCCCAGGTTATCAGG - Intronic
1050887600 9:10785115-10785137 ATCATTATGACTAGTTTATTAGG - Intergenic
1050996708 9:12229729-12229751 ATTATTAGGACAGGTGTAGCCGG - Intergenic
1052718595 9:32147771-32147793 ATAATTAGCTCAACTTAATCAGG + Intergenic
1056304913 9:85280731-85280753 ATTCTTAGGACAAGTTAATTGGG - Intergenic
1186077423 X:5896341-5896363 ATAATCTCCACAAGTTTATCTGG - Intronic
1187877122 X:23813624-23813646 ATGAATAGGACAAGTATATCTGG + Intergenic
1188406626 X:29818511-29818533 AGATTTAGGAAAAATTTATCAGG + Intronic
1189091976 X:38093100-38093122 ATAAACAAGAAAAGTTTATCAGG - Intronic
1192915473 X:75646784-75646806 TAAATTAGGACAATTTAATCCGG - Intergenic
1202375190 Y:24228932-24228954 AAAATTAGGAAAATTTCATCAGG + Intergenic
1202495590 Y:25441188-25441210 AAAATTAGGAAAATTTCATCAGG - Intergenic