ID: 1026389731

View in Genome Browser
Species Human (GRCh38)
Location 7:69888351-69888373
Sequence GAGAGGAAACAAGAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 965
Summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 852}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026389731 Original CRISPR GAGAGGAAACAAGAGGATGG GGG Intronic
900031145 1:373941-373963 GAGAAGAAAGGAGAGGAGGGTGG - Intergenic
900051712 1:602190-602212 GAGAAGAAAGGAGAGGAGGGTGG - Intergenic
900300849 1:1976382-1976404 GAGGGGAAGCAAGAGGGTGGAGG - Intronic
900543485 1:3215749-3215771 GAGGGGAAACCAGAGGACGTGGG - Intronic
901121584 1:6898817-6898839 GCTAGGCAACAAGAGGCTGGAGG - Intronic
901385305 1:8904402-8904424 GAGAGGAAAGGAGAGGAGAGGGG - Intergenic
901755976 1:11441841-11441863 GAGAGGAGACAGGAGGAGAGAGG + Intergenic
902086425 1:13866438-13866460 AAGACGAAAAAAGAGCATGGTGG - Intergenic
902095376 1:13939852-13939874 GAGTGGGAGCAAGAGGGTGGTGG + Intergenic
902653839 1:17854070-17854092 GAAAAGAAAGAAGAGGAAGGAGG - Intergenic
902657182 1:17877311-17877333 GAGGGAGAACAAAAGGATGGAGG - Intergenic
903109828 1:21122100-21122122 GAGGGGGAATTAGAGGATGGTGG - Intronic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
903335080 1:22619247-22619269 GAGAGGGGAGAAGAGGATGGAGG - Intergenic
903740441 1:25555649-25555671 GAGACAAAGCAAGAGGGTGGAGG - Intronic
904371521 1:30050473-30050495 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
904375846 1:30081983-30082005 GAGGAGGAACAAGAGGAGGGAGG - Intergenic
904558989 1:31384262-31384284 GGAAGGAAACAAGAGGGAGGAGG + Intergenic
905902756 1:41592634-41592656 CAGAGAAGCCAAGAGGATGGTGG - Intronic
905959578 1:42032629-42032651 GGGGGGCAATAAGAGGATGGAGG - Intronic
906616871 1:47239516-47239538 GAGACCAAAAAAGAGGAAGGAGG - Intergenic
906711121 1:47930649-47930671 AAGAGGAGACCAGAGGATGAAGG - Intronic
907279115 1:53333943-53333965 CAGAGGAAAGGAGAGGATGAAGG + Intergenic
907715519 1:56922658-56922680 GTGAGGATACAAGAAGATAGTGG + Intergenic
907797287 1:57730246-57730268 GAGAGAAAACAAGAGGTTCAGGG + Intronic
907812464 1:57884886-57884908 GAGAGGAAACAAGAGGTAGAGGG - Intronic
907964411 1:59315383-59315405 GAGAGGAGAAAAGAGAAGGGAGG - Intronic
908250345 1:62260776-62260798 TAGAAGAAATAAGAGGATTGTGG - Intronic
908322406 1:62991220-62991242 GAGAGGAGACAGGAGGAGGTGGG + Intergenic
908422740 1:63975200-63975222 AAGAGGAAAAAAGAGGATACTGG + Intronic
908499513 1:64729240-64729262 GAGAGGGAGCAAGAGTAGGGGGG + Intergenic
909221668 1:72970793-72970815 GAGAGGAAAAAAAAGCATGAGGG - Intergenic
909392858 1:75136173-75136195 GAGAGAAGAAAAGAGGATTGAGG - Intronic
910297576 1:85665617-85665639 GAGGGGAAAAAAGTGCATGGAGG - Intronic
910700058 1:90063754-90063776 GAGAGGAGAGAGGATGATGGAGG + Intergenic
911900746 1:103500462-103500484 GAGAGGAAAGGAGAGAATAGGGG - Intergenic
911971815 1:104448365-104448387 GAGAGGAAAGGAGAGGAGGGAGG - Intergenic
912617865 1:111123810-111123832 GGGAGGAAGCAAGGGGGTGGTGG - Intronic
913585736 1:120273640-120273662 GAGAGGCAAGAAGAGGGTGTAGG + Intergenic
913622449 1:120624729-120624751 GAGAGGCAAGAAGAGGGTGTAGG - Intergenic
914287526 1:146241105-146241127 GAGAGGGAGCAAGAGGGGGGGGG - Intergenic
914567742 1:148885499-148885521 GAGAGGCAAGAAGAGGGTGTAGG + Intronic
914605081 1:149244746-149244768 GAGAGGCAAGAAGAGGGTGTAGG - Intergenic
915057969 1:153153653-153153675 GAGTGGAAAGAAGAGGAAAGGGG + Intergenic
915453768 1:156025303-156025325 GAGAGGGAACAAGAGGGTGAAGG - Intergenic
915890904 1:159772880-159772902 CAGAGAAATTAAGAGGATGGGGG - Intergenic
916059510 1:161089012-161089034 GGGAGGAAACAAGAAGGGGGAGG + Intronic
916239927 1:162629248-162629270 GAGAGGAAAGAAGAGAAGAGAGG + Intergenic
916400245 1:164439979-164440001 GAGAGGAGAGGAGAGGAGGGAGG + Intergenic
916400260 1:164440026-164440048 GAGAGGAGAGGAGAGGAGGGAGG + Intergenic
916679393 1:167090281-167090303 GAGAAGAAGCAAGACCATGGTGG - Exonic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
918128692 1:181606376-181606398 GACAGAAAACAAGAGGGTGAAGG - Intronic
918719758 1:187838282-187838304 CAGAATAGACAAGAGGATGGAGG + Intergenic
919973468 1:202595546-202595568 GGGTGGTAAGAAGAGGATGGGGG - Exonic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920263681 1:204706708-204706730 GAGAGATAAGAAGAGGAGGGTGG + Intergenic
921995782 1:221416617-221416639 GTGGGGAAAGAAGAAGATGGAGG - Intergenic
922189807 1:223308332-223308354 GAGCAGGAACAAGAGGGTGGGGG - Intronic
922212909 1:223499190-223499212 GAGAGGGAGCAAGAGCAGGGAGG - Intergenic
922348332 1:224715691-224715713 GAGAGGAAATGAGAGGGTTGGGG + Intronic
922391045 1:225141699-225141721 CAGCGGAAAGAAGAGGCTGGAGG - Intronic
922665533 1:227465600-227465622 GAGAGCAAACATGCAGATGGTGG + Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922784451 1:228276152-228276174 GAGCGGAAAAGAGAGGAGGGAGG + Intronic
922904054 1:229160335-229160357 GAGAGGAAGCAAGAGAGAGGAGG - Intergenic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923040059 1:230313242-230313264 GAGAGGGAGGAAGAGGAGGGAGG + Intergenic
923226166 1:231940655-231940677 GAGAGGAAGGAAGGGGGTGGGGG + Intronic
923282210 1:232454688-232454710 AAGAGGAATGCAGAGGATGGCGG - Intronic
923554242 1:234988018-234988040 GAGAGGAAAGTTGAGGCTGGAGG - Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1064709790 10:18111605-18111627 GAAAGAGAGCAAGAGGATGGGGG + Intergenic
1065406914 10:25378517-25378539 AAGAGGAAAAAAGAGCATAGTGG - Intronic
1065593619 10:27291050-27291072 GAGAGGAAAGGAGAGGAAGAAGG - Intergenic
1065787163 10:29227358-29227380 GAGAGGAATCAAGAGAAAGATGG + Intergenic
1065787533 10:29230143-29230165 GAGGGGAAACCAGAGGAGGTTGG - Intergenic
1065902904 10:30224141-30224163 GAGAGGAAGCAAGAGAGAGGGGG - Intergenic
1066046382 10:31599057-31599079 GAGAGGAAGCAAGAGGTGGGGGG - Intergenic
1066224680 10:33370600-33370622 CAGAGGAAACAAGAGAGGGGAGG - Intergenic
1066322108 10:34313759-34313781 GGGAGGCAACAGGATGATGGGGG + Intronic
1067427475 10:46220841-46220863 GGGAGGACACAGGAGGAAGGTGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067582905 10:47456751-47456773 GGGAGGACACAGGAGGAAGGCGG + Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068431682 10:56941410-56941432 GAAAGAAAGAAAGAGGATGGAGG + Intergenic
1069055357 10:63839136-63839158 GAGAGGAAACTAAAAGGTGGTGG + Intergenic
1069943381 10:71970229-71970251 GAGGGGGATCAAGAGGACGGAGG - Intronic
1069998769 10:72360493-72360515 GAGAGAAATCTAGAGGCTGGTGG - Intergenic
1070407981 10:76113453-76113475 GAGAGGAAAGAAGATGAGGGGGG + Intronic
1070627624 10:78062453-78062475 GAAGAGAAAGAAGAGGATGGTGG - Intergenic
1070697829 10:78575886-78575908 GAGAGGAAAGAAGAGCAAGAAGG + Intergenic
1070868231 10:79723511-79723533 GAGAGGAAACAAGAAAGAGGTGG + Intergenic
1070955880 10:80463165-80463187 GAAACGAAACAAGGGGAAGGAGG - Intronic
1070969206 10:80549665-80549687 GGAAGGAAACAAGAGCAAGGTGG - Intronic
1071332770 10:84576228-84576250 GAGAAGAAAAACGAGGAGGGTGG - Intergenic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1071635143 10:87245712-87245734 GAGAGGAAACAAGAAAGAGGGGG + Intergenic
1071660102 10:87492280-87492302 GAGAGGAAACAAGAAAGAGGAGG - Intergenic
1072036821 10:91570391-91570413 GAGAGGAAGCAAGAGAGAGGGGG - Intergenic
1072199092 10:93142831-93142853 GAGAGGAAACAAGGGAATCCAGG + Intergenic
1072300524 10:94056794-94056816 GGGTGGAAAGGAGAGGATGGGGG - Intronic
1073021562 10:100448971-100448993 GAGAAGAAAGAAGAAGAAGGAGG + Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073512005 10:104048399-104048421 CAGAGGAGACAAGAACATGGAGG - Intronic
1073895611 10:108152917-108152939 GAGAGGAAAGTAGAGGATGTAGG + Intergenic
1074308708 10:112302535-112302557 CAGAGGAAACTAGGGTATGGAGG - Intronic
1074517334 10:114182284-114182306 GAAAGGAAACAAGAAGTTTGTGG + Intronic
1074955873 10:118388636-118388658 GTGAGGACACAGGAGGAAGGTGG + Intergenic
1074978113 10:118596975-118596997 AAAAGGAAACAAGAGGCTGAGGG - Intergenic
1075132869 10:119755330-119755352 GTGAAGACACAAGGGGATGGTGG - Intronic
1075361345 10:121838131-121838153 GAGTGGAAACAGGAGGCTGCTGG - Intronic
1075427604 10:122353954-122353976 GAGAGGGAGCAAGAGGAAGGAGG - Intergenic
1075741348 10:124698243-124698265 GAGAGGCCACACCAGGATGGGGG + Intronic
1076238138 10:128881719-128881741 GAGTGAAAAGAAGACGATGGAGG + Intergenic
1076478802 10:130770308-130770330 GAGAGGAAGCCAGAAGAGGGCGG - Intergenic
1076514424 10:131035819-131035841 GAGAGGAAACAGGAGCTTTGGGG + Intergenic
1076637597 10:131892373-131892395 GCGTGGGGACAAGAGGATGGTGG - Intergenic
1076811168 10:132887192-132887214 GAGAGGAAAGAAGAGGAGAGAGG - Intronic
1076811244 10:132887611-132887633 GAGAGGAGAGAAGAGGAGAGAGG - Intronic
1076811291 10:132887886-132887908 GAGAGGAGAGAAGAGGAGAGAGG - Intronic
1077531359 11:3097116-3097138 GAGAGGAAAGAAGGGGAAGATGG + Intronic
1077704620 11:4472772-4472794 GAGAGGATATAAGATCATGGAGG + Intergenic
1077783088 11:5353482-5353504 GGGAGGAAGGGAGAGGATGGAGG + Intronic
1077939053 11:6819992-6820014 GAGAGGAAACAAGAGAGAAGTGG - Intergenic
1079206188 11:18416828-18416850 GAGAGGAAAGGAAAGGATGGAGG - Intronic
1079766139 11:24395637-24395659 GAGAGGAATTAAAAGGATAGTGG + Intergenic
1079995862 11:27294323-27294345 GAGAGGAAGCAAGAGAGAGGGGG - Intergenic
1080247506 11:30196223-30196245 GAGAGGTAAGAAGAGGAGGGCGG + Intergenic
1080469064 11:32527648-32527670 GGGAGGAAAGAAGAGAAAGGGGG + Intergenic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081489511 11:43556650-43556672 GAGAGAGAAAAAGAGGGTGGGGG - Intronic
1083944280 11:65915491-65915513 GAGCGGGGACAAGAGGAGGGTGG + Intergenic
1084343623 11:68527439-68527461 GACAGGAAAGAAGGGGATGAAGG - Intronic
1084463323 11:69308260-69308282 GAGAGGCAAGATGAGGTTGGAGG - Intronic
1084533693 11:69744636-69744658 GGCAGGAAACCAGAGGCTGGGGG - Intergenic
1085141619 11:74149171-74149193 TGGAGGAAACAAGTGGATGTGGG - Intronic
1085295749 11:75430696-75430718 GAGAGGAAATAAACGGATGAGGG - Intergenic
1085328286 11:75625432-75625454 GAGAGAAGAGAAGAGGATGTTGG + Intronic
1085362247 11:75900370-75900392 GAGAGAAAAAAAGAGAATGAGGG - Intronic
1085516272 11:77113581-77113603 GATAGAAAACAAGAGAAAGGGGG + Intronic
1086445510 11:86866815-86866837 GAGAGGAAGCAAGAGATGGGTGG - Intronic
1086494931 11:87393008-87393030 GGGAGAAAAAAACAGGATGGAGG - Intergenic
1087264386 11:96044434-96044456 GAGAGGAAGGGAGAGAATGGGGG - Intronic
1087358485 11:97125491-97125513 GAAAGGAAACGAGAGGAGAGGGG - Intergenic
1087574932 11:99977704-99977726 GAGAGGTAACTAGATCATGGTGG - Intronic
1087849206 11:103009353-103009375 GAGGGGAAACATGGGGTTGGAGG - Intergenic
1087977597 11:104569010-104569032 AAGAAGAAAAAAGAGTATGGTGG + Intergenic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1088657419 11:112013953-112013975 GAGAGGAAGCAAGAGAGTGGAGG + Intronic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089128924 11:116197140-116197162 GAGAGAGAACAAGAGAATGGTGG + Intergenic
1089248408 11:117138848-117138870 GGGAAAAAAAAAGAGGATGGAGG - Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089597615 11:119591133-119591155 GAGAAGAAGGAAGAGAATGGGGG + Intergenic
1089637020 11:119821347-119821369 GAGAGGACACATCAGGGTGGGGG - Intergenic
1089658617 11:119970966-119970988 GAGAGGGAGCGAGAGGCTGGGGG + Intergenic
1089845183 11:121452637-121452659 GAGAGGAAAAAACTGGAGGGAGG - Intronic
1090245742 11:125214762-125214784 GAGAGAGAAAAAGAGGAGGGTGG - Intronic
1090352591 11:126116619-126116641 GAAAAGAATCCAGAGGATGGGGG - Intergenic
1090569096 11:128028013-128028035 AAGAGGAAGAAAGAGGAAGGAGG + Intergenic
1090697969 11:129267868-129267890 GAGAGGAAGCAAGTGGAGGGAGG + Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091316513 11:134617743-134617765 GAGAGGAAATATGGGGTTGGAGG + Intergenic
1091600101 12:1912811-1912833 GACAGGAAGCAAGAGGAGAGGGG - Intronic
1091647120 12:2282295-2282317 GATAGGAAAGAAGAAGAGGGAGG - Intronic
1091702379 12:2672628-2672650 GAGAGGACACAAGACCCTGGAGG - Intronic
1091772510 12:3162160-3162182 GAGAGGAAGCAAGACAGTGGGGG - Intronic
1092061564 12:5555308-5555330 AACAGGAAAGAAGAGGATGGGGG + Intronic
1092449986 12:8593236-8593258 GAGAGGAGAGGAGAGGATGGGGG + Intergenic
1092498863 12:9025897-9025919 GAGAGGAAATAATAGGTTTGGGG + Intergenic
1092724661 12:11473710-11473732 GAGAGCAAGCAAGAGAAAGGAGG - Intronic
1093055851 12:14554928-14554950 GAGAGAAAACACCACGATGGAGG - Intronic
1093413784 12:18896508-18896530 GAGAGGAAAGAAGAGCAATGTGG - Intergenic
1094464414 12:30736792-30736814 GAGAGAAGAAAAGAGGACGGAGG + Intronic
1094502245 12:31032064-31032086 GAGAGGAAACAAGAGAGAAGAGG - Intergenic
1094564209 12:31584988-31585010 GAGAGGAACGAAGAGGGTAGGGG + Intronic
1095086553 12:38062511-38062533 GAGAGGAAATGAGGGGATGTTGG + Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095417163 12:41989677-41989699 GAGAGGTAACATGAAGATGGAGG + Intergenic
1095631180 12:44379132-44379154 GAAAGGAAGAAAGAGGAGGGAGG + Intronic
1096314862 12:50555717-50555739 GAAAGGAAACAAGAGGTGAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655333 12:53087196-53087218 GAGAGGAAGCAAAAGGTTAGAGG + Intergenic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097107921 12:56636054-56636076 GAGAGGAAACAGGACTCTGGGGG - Intronic
1097152498 12:56989328-56989350 GAGAGGAAAAAAATGGCTGGTGG + Intergenic
1097307105 12:58081438-58081460 TAGAAGAAAAAAGAGCATGGGGG + Intergenic
1097477653 12:60078608-60078630 GATAGGAAAGAGGAGGATGAGGG - Intergenic
1097541470 12:60949221-60949243 AGGAGGAAAGAAGATGATGGTGG - Intergenic
1097703579 12:62845368-62845390 TGGAGGCAAGAAGAGGATGGAGG - Intronic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098116558 12:67184788-67184810 GAGAGGAGAGAAGAGGAGAGGGG + Intergenic
1098178431 12:67819068-67819090 CAGAGGAAACGAGATGATGTAGG + Intergenic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1099031692 12:77533669-77533691 GAGAGGGAAAAAGAGAAAGGAGG + Intergenic
1099133643 12:78865338-78865360 AAGAGGAAGCAAGAAGATGGGGG - Intronic
1099224188 12:79949469-79949491 AAGAGGAGACAAGGGGATGAGGG - Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1099855342 12:88157541-88157563 TAGAGAAAAAAAGAGGATGAAGG - Intronic
1100029843 12:90173130-90173152 GAGAGGAAAGAACAGGAGAGAGG - Intergenic
1100348702 12:93757477-93757499 GAGATGAAACAGGAGGCTTGTGG - Intronic
1101059842 12:100959331-100959353 GAGAGGAAAAATGATGATGCAGG - Intronic
1101236422 12:102794545-102794567 GAGAAGAAAGGGGAGGATGGAGG - Intergenic
1101274897 12:103188693-103188715 GAGAGGAAGCAAGAGAGAGGTGG - Intergenic
1101690767 12:107078441-107078463 GAGAGGTAAAAAGAGGATCCAGG - Intronic
1102623594 12:114216677-114216699 GAAAGGAAAAAAAAGGAGGGAGG + Intergenic
1102822955 12:115923788-115923810 GAGAGGAAACAAGGAGAATGAGG - Intergenic
1103382463 12:120505091-120505113 GAGAACAAACAAGAGGTTTGTGG - Intronic
1103490682 12:121317062-121317084 GAGAGGTTACCAGAGGCTGGGGG + Intronic
1103846935 12:123908303-123908325 GAGAAGAAAGAGGGGGATGGAGG - Intronic
1104209599 12:126676038-126676060 GAGTGGGAACTAGAGGATGGTGG - Intergenic
1104373607 12:128245256-128245278 CAGAGGAGACAAGAGGATGTGGG - Intergenic
1104895629 12:132162329-132162351 GAGAGGAGACAAGAGAGGGGAGG - Intergenic
1105840682 13:24251485-24251507 GAGATGAAACATGAGGCTGCAGG + Intronic
1106097498 13:26660958-26660980 GAGAGGAAACAAGGAGTGGGAGG + Intronic
1106295715 13:28412026-28412048 GCTAGGAAACAAAAGGATAGAGG + Intronic
1106408205 13:29492410-29492432 GGGAGGGAAAAAGAAGATGGGGG - Intronic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1106588161 13:31074972-31074994 GAGAGGAAGCAAGAGAGAGGAGG - Intergenic
1106738224 13:32609959-32609981 TAGAGGAAAAAAGTTGATGGAGG + Intronic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1107115563 13:36742266-36742288 GATAGAAAACAAGAGAAAGGCGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107810595 13:44196427-44196449 GACAGGAAAAAAGAGGCTGTGGG - Intergenic
1108048013 13:46401670-46401692 GAGAGAGAAAAAGAGGAAGGAGG - Intronic
1108230571 13:48335913-48335935 CTGAGGAAAAAAGAGAATGGTGG + Intronic
1108749094 13:53428743-53428765 CAGAGGACACAAGAGGAGCGGGG - Intergenic
1108770051 13:53688625-53688647 GAGAGGCAAAAAGAGGATCTCGG + Intergenic
1110241851 13:73276651-73276673 GAGAGGGCACAAGGGGGTGGGGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111335280 13:86813515-86813537 GAGAGGAAGCAAGAGGGAGATGG - Intergenic
1111679962 13:91430181-91430203 ATAAGGAAAAAAGAGGATGGTGG + Intronic
1111919695 13:94397154-94397176 GAGAGGAAAGAAGGGCATTGGGG + Intronic
1112574998 13:100627618-100627640 GAGGTCATACAAGAGGATGGTGG - Intronic
1112838639 13:103548063-103548085 GACAGGAAACAGGAGGCTGGAGG - Intergenic
1113292509 13:108922250-108922272 GAGAGGAAAGAGGAGGAAAGAGG + Intronic
1113734054 13:112664483-112664505 GAGGAGAAAGAAGAGGAAGGTGG - Intronic
1114352300 14:21866451-21866473 CAGAGGAAACAATACGAAGGAGG - Intergenic
1114551282 14:23534175-23534197 GAGGGGCAAGAAGAGGATGGAGG - Exonic
1114709678 14:24765906-24765928 GGGATGAGAAAAGAGGATGGGGG - Intergenic
1115267939 14:31520895-31520917 GAGATGAAACACAGGGATGGGGG + Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1116255844 14:42554261-42554283 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1116688382 14:48072741-48072763 CAGAGGAAACAAGACGGTGTGGG + Intergenic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118346233 14:64943050-64943072 GAGAGGAAAAAAAGGGAGGGAGG + Intronic
1118990948 14:70796564-70796586 GAGAGGAGACAGGGAGATGGAGG - Intronic
1119041515 14:71278714-71278736 GAGAAGAAAAGAGAGGAAGGAGG + Intergenic
1119598124 14:75955445-75955467 GGGAGGAAGCAAGAGGGCGGAGG - Intronic
1120296589 14:82649046-82649068 TAGTGGAAAAAAGAGGCTGGAGG + Intergenic
1120420864 14:84284286-84284308 GAAAGGAAAGAAGAGGAGGAGGG + Intergenic
1120601345 14:86514106-86514128 GAGAGGAAACTAGAGTGGGGTGG - Intergenic
1120751466 14:88202566-88202588 GAGACGAAAGAGGAGGACGGAGG - Intronic
1120811135 14:88804432-88804454 AAGAGGGAACAAGAGGAAGCTGG - Intergenic
1121079077 14:91093130-91093152 AACAGAAAACAAGAGGTTGGAGG + Intronic
1121567830 14:94923870-94923892 GAGAGGAAAGAAGAGGACAGAGG - Intergenic
1121672432 14:95723023-95723045 GAGAGGAAGCAAGAGATTGGGGG - Intergenic
1122117734 14:99536091-99536113 GGAAGGACACAAGAGGAAGGGGG + Intronic
1122215231 14:100199258-100199280 GAGAGGAAACAAGAGGACAGAGG - Intergenic
1122647895 14:103207278-103207300 GAGAGGAGAAAAGAGGAGGAGGG - Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1202928361 14_KI270725v1_random:15050-15072 TCCAGGCAACAAGAGGATGGAGG - Intergenic
1123811875 15:23935161-23935183 GAGAGGAAGCAAGAGAGAGGTGG - Intergenic
1124008204 15:25811290-25811312 GAGAGGAAAGAGGAGGACAGAGG + Intronic
1124156857 15:27233511-27233533 GAGAGGACACAAGGAGAAGGTGG - Intronic
1124420459 15:29516590-29516612 GAGAGCAAAGGAGGGGATGGGGG + Intronic
1124847814 15:33309392-33309414 GAGAAGAAAAGAGTGGATGGTGG + Intergenic
1125697488 15:41651619-41651641 GAGAGGAGAGAAGAGGAGAGAGG - Intronic
1125843091 15:42824030-42824052 GAAAGGAAGCAAGAAGGTGGGGG + Intronic
1127099423 15:55550186-55550208 GCAAGGAAAAAACAGGATGGAGG - Intronic
1127392957 15:58521665-58521687 GAGGGGAAGAAAGAGGAAGGGGG + Intronic
1127421192 15:58807978-58808000 GAGAGGAAAGAAGGAGAGGGAGG - Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127688501 15:61371782-61371804 AAGAGGAAGCAAGGGGAAGGAGG + Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1129060074 15:72853748-72853770 AAGAGTAGGCAAGAGGATGGAGG - Intergenic
1129249063 15:74298314-74298336 GAGAGGAAAAAATAGAGTGGAGG + Intronic
1129751276 15:78066277-78066299 GAGAGTCAACCCGAGGATGGAGG + Intronic
1130024399 15:80259043-80259065 GATAGGTAGCCAGAGGATGGAGG + Intergenic
1130039903 15:80397765-80397787 GAGAGGAGACAAGAATATGTGGG - Intronic
1130226052 15:82059011-82059033 GGGAGAAAACAAGAGGGAGGAGG - Intergenic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130629398 15:85550864-85550886 GAGTGGAAACTAGAGAATGGGGG + Intronic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1130948486 15:88567348-88567370 GAGTGTAAAGAAGAGGCTGGGGG + Intergenic
1131338384 15:91572234-91572256 CAGAGGGAATAAGAGGCTGGAGG + Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131627987 15:94144595-94144617 GAGAGGAAGCAAGCAGGTGGGGG - Intergenic
1132396318 15:101477736-101477758 AAGAGGAGAGAAGAGGCTGGAGG - Intronic
1132544851 16:528261-528283 CAGAGGAACCCAGAGGAAGGCGG + Intronic
1132943163 16:2518515-2518537 GTGAGCCAAGAAGAGGATGGGGG - Intronic
1133392849 16:5423079-5423101 GAGAGGGAGGAAGAGGAAGGAGG + Intergenic
1133517279 16:6521526-6521548 GAGAGGAGAGGAGAGGAAGGAGG - Intronic
1134800185 16:17077028-17077050 GAGAGGAAAGAGGTGGATGATGG - Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135748300 16:25036288-25036310 GAGAGGAGAGGAGAGGAGGGTGG - Intergenic
1135795219 16:25434964-25434986 GAGAGGAAAGTAGGGGATGTAGG - Intergenic
1136094772 16:27947338-27947360 GAGAAGAAAGAAGAAGAAGGAGG + Intronic
1136591553 16:31220868-31220890 GAGAGAGAAAAAGAGAATGGTGG - Intronic
1137570503 16:49563286-49563308 GAGAGGGAGCAAGAGGGAGGGGG - Intronic
1138276584 16:55739354-55739376 GAGATGAAACAAGAAGACAGAGG - Intergenic
1138282502 16:55782745-55782767 GAGATGAAACAAGAAGACAGGGG - Intergenic
1138286438 16:55813874-55813896 GAGATGAAACAAGAAGAGAGAGG + Intronic
1138455060 16:57116361-57116383 GTTAGGAACCAAGAGGTTGGGGG - Intronic
1138602354 16:58063614-58063636 CAGAGGAAAGAAGGGGGTGGGGG - Intergenic
1138806221 16:60092387-60092409 GAAAGGAAAGAAGAGGAGGAAGG + Intergenic
1138963085 16:62051044-62051066 GAGAGGAAACAAGAGACAGTGGG - Intergenic
1139010650 16:62628940-62628962 GAGAGGAAGCAAGAGACGGGAGG + Intergenic
1139355645 16:66365786-66365808 CAGAAGAACCAAGAGGCTGGGGG - Intergenic
1139477508 16:67210016-67210038 GAGAGGAAGGAAGGGGATGATGG + Intronic
1139487422 16:67265807-67265829 GGGCTGAAAGAAGAGGATGGGGG + Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140023416 16:71261258-71261280 CAGAGGAAAGAAGAGGAAAGAGG + Intergenic
1140083926 16:71777296-71777318 GAGAGGCTACCAGAGGGTGGGGG + Intronic
1141068294 16:80931877-80931899 GAGAGGAAAGGAGAAGAAGGAGG + Intergenic
1141218550 16:82047583-82047605 GAGAAGAGGCAAGAGGATGTAGG + Intronic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1142973848 17:3631311-3631333 GGGAGGAAAGAAGAGCAGGGTGG + Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143142443 17:4748795-4748817 GAGAGAAAAGATGAGGAGGGAGG - Intergenic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1143977863 17:10843769-10843791 GGGAGGAAACAAGCAGGTGGGGG - Intergenic
1144052129 17:11505937-11505959 ATGAGGAAAGAAGAGGGTGGGGG + Intronic
1144279619 17:13712409-13712431 GAGGGAAAAGAAGAGGAAGGTGG + Intergenic
1145187936 17:20811930-20811952 GAAAAGAAACAAGAGGAAGTAGG + Intergenic
1145903706 17:28505192-28505214 GACAGGAGACAAGGGGATGGAGG + Intronic
1146436507 17:32853963-32853985 AAGAGGAAATAAGAGGTTGGGGG - Intronic
1146497209 17:33333788-33333810 GAGAGGAAAGAGGAGGATTATGG + Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1147381749 17:40060378-40060400 GAGAGGTAAAAAGAAGATGGGGG + Intronic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1148698581 17:49575503-49575525 GAGAGGAAGGGAGAGGGTGGTGG - Intergenic
1148720399 17:49748482-49748504 CTGAGGAATCAAGAGAATGGTGG + Intronic
1148763446 17:50021734-50021756 CAGTGGAATGAAGAGGATGGGGG - Intergenic
1149423140 17:56530229-56530251 AAGAGGAAAAAAGAGGTTGGGGG - Intergenic
1149967923 17:61186035-61186057 GAGATGTAACATTAGGATGGAGG + Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150176998 17:63067770-63067792 GAGAGAAAAGCAGGGGATGGCGG + Intronic
1150221983 17:63500940-63500962 GAGAGGCAACATGGGGAGGGAGG - Intronic
1150478094 17:65489035-65489057 GAGAGGAAGAGAGAGGAAGGAGG + Intergenic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1150566828 17:66349495-66349517 GAGAGGAAACAAGGGTGTGATGG - Intronic
1151249239 17:72820819-72820841 GAGGAGAAACATGTGGATGGGGG + Intronic
1151994322 17:77599064-77599086 GAGAGGATATGAGATGATGGTGG + Intergenic
1152084063 17:78206656-78206678 GAGAAGAAAGAAGATGAAGGAGG - Intronic
1152486158 17:80594996-80595018 GAGAGGGAGAAAGAGAATGGGGG + Intronic
1152677976 17:81651345-81651367 GGGAGGGAACCAGAGGAGGGTGG + Intronic
1152696539 17:81800505-81800527 GAAGGGAAACAGGAGGGTGGTGG - Intergenic
1152731674 17:81975110-81975132 GAGAAGAAAGAAGAAGAGGGAGG - Intergenic
1152908648 17:82984436-82984458 GAGAGGCCACAGGAGGATGCAGG + Intronic
1152908664 17:82984506-82984528 GAGAGGCCACAGGAGGATGCAGG + Intronic
1152913073 17:83016596-83016618 GAGAGGACTGAAGAGGAGGGGGG + Intronic
1152948508 17:83211772-83211794 GAGAAGAAAGGAGAGGAGGGTGG + Intergenic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153323981 18:3799344-3799366 GAGAGGGAAGAAGAGGAGTGTGG + Intronic
1154319553 18:13336081-13336103 GAGAGGAAGCAAGAGAGTGCAGG + Intronic
1155538979 18:26847180-26847202 GAGAGGAAAAGAGAAGAGGGAGG - Intergenic
1155725990 18:29083951-29083973 GACAGGAAAGAGGAGGCTGGTGG + Intergenic
1155982343 18:32194501-32194523 GAGAGGAAAAGAGAGGAGAGGGG - Intronic
1156478420 18:37421008-37421030 GAAAGGAAAGAAGAGGAGGAGGG - Intronic
1156778390 18:40821532-40821554 GAGAGGAAAAAAGAGCAGAGTGG + Intergenic
1157239826 18:45998586-45998608 GAAAGGAAAGAAGAGGAGAGAGG - Intronic
1157531675 18:48426475-48426497 GAGAGGCAATTTGAGGATGGAGG - Intergenic
1157924864 18:51752602-51752624 GAATGGAAACCAGAGGCTGGGGG - Intergenic
1158014151 18:52764555-52764577 GAGAGGAAACAAGAGGGAGAGGG - Intronic
1158369520 18:56784121-56784143 GAAAGAAAACAAAAGGCTGGGGG - Intronic
1158497067 18:57965846-57965868 GAGCGCAGGCAAGAGGATGGAGG + Intergenic
1158811006 18:61034492-61034514 GAGAGGAAGCAAGAGAAGGTAGG + Intergenic
1159384496 18:67706294-67706316 GAAAGCAAGCAAGAGGATGGTGG + Intergenic
1160130259 18:76218927-76218949 GAGAGGATACTGGAGCATGGGGG + Intergenic
1160448693 18:78947186-78947208 AAGAGGGAAGAAGAGGATGGAGG + Intergenic
1160455545 18:78996460-78996482 GAGAGAAAGCAAGAGGAGAGGGG + Intronic
1161170920 19:2812185-2812207 GTGAGGAAACTGGAGGTTGGAGG - Intronic
1161619932 19:5292641-5292663 GAGCGGAAACAAATGGATGGAGG + Intronic
1161724248 19:5919185-5919207 GAGAGGAGACGAGAGGACTGTGG + Intronic
1161734119 19:5979917-5979939 GGGAGGGAACAAGGGGAGGGAGG - Intergenic
1161789528 19:6350683-6350705 GAGAAGAAAAAAGAGGATGTGGG + Intergenic
1161946094 19:7438028-7438050 GAGAGGAGAGAAGAGGAGAGGGG - Intronic
1162146006 19:8612322-8612344 GGGAGCAAACAGGAGGGTGGGGG - Intergenic
1162462150 19:10819650-10819672 GTGAGGGAAAAGGAGGATGGAGG + Intronic
1162600602 19:11665464-11665486 CAGTGGGCACAAGAGGATGGGGG + Intergenic
1162686545 19:12390206-12390228 GAGAGTATACAAGAGGATGTGGG + Exonic
1162690878 19:12429896-12429918 GAGACTATACAAGAGGATGTGGG + Exonic
1163066564 19:14800917-14800939 GAGAGGAAAGGACAGGCTGGTGG - Intronic
1163116266 19:15190571-15190593 GAGAGAAAAAAAGATGATGCTGG - Intronic
1163179318 19:15587828-15587850 GAAAGGGAGCAAGAGGAAGGTGG - Intergenic
1163223700 19:15939809-15939831 GAGGGGAACCAAGAGGATATGGG + Intergenic
1163489662 19:17609742-17609764 GGGAGGGGACACGAGGATGGAGG - Intronic
1163529412 19:17841125-17841147 GAGATTAAACAAGAGGCTGTAGG + Intronic
1164441378 19:28282870-28282892 CAGTGGGAAGAAGAGGATGGTGG - Intergenic
1164581811 19:29439339-29439361 GAGAGGAAAAGAGGGGAGGGGGG + Intergenic
1166024553 19:40069301-40069323 GAGAGAAAACAAGAGGGTGAGGG + Intronic
1166151908 19:40880985-40881007 GAGATGGAGGAAGAGGATGGAGG + Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1168579693 19:57544509-57544531 GAGAGGATGCAGGAGGGTGGGGG + Exonic
925332361 2:3068514-3068536 GAGAGGAGAGGAGAGGAGGGGGG + Intergenic
925862600 2:8194475-8194497 GAGAGGAGGGAGGAGGATGGTGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926437778 2:12854947-12854969 GAGAGGAAACAAGAGATTACAGG + Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
926873108 2:17445612-17445634 GAGAGGAAGCAAGAGCAGTGTGG + Intergenic
927046807 2:19287253-19287275 GATAGGGAACAAGAGGGTGATGG - Intergenic
927127685 2:20027650-20027672 GAGAGGCAACACTGGGATGGTGG - Intergenic
927259881 2:21077571-21077593 GACAGGAAGCAAGATGCTGGTGG + Intergenic
927616360 2:24600674-24600696 GAAAGAAAGCAAGAGGATGTAGG - Intronic
927618352 2:24623737-24623759 GTGAGGACACAGGAAGATGGCGG - Intronic
928017651 2:27673365-27673387 GAAAGGAAAAAAGAGAAGGGAGG - Intronic
928300465 2:30119491-30119513 GAGAGGAAACTAGAGGAGCAGGG - Intergenic
928311109 2:30210664-30210686 GAGAGGAAACAAGAGTTTGTGGG + Intergenic
928737724 2:34311401-34311423 GATAGGAAAGGAGAAGATGGAGG + Intergenic
929250084 2:39743654-39743676 GAGAGGAAGCAAGAGGGAGAAGG - Intronic
930060517 2:47284324-47284346 GAAAGGAAACAAGGAGATGGTGG - Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930371573 2:50508107-50508129 GAGAGAAATCAATAGGCTGGTGG - Intronic
930450607 2:51532153-51532175 GAAAGGAAACACGATGATTGTGG - Intergenic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
931066222 2:58590598-58590620 GAGAGGAGACACAAGGTTGGAGG - Intergenic
931249386 2:60516493-60516515 GAGAGGAGCCAAGAGGGAGGGGG + Intronic
932428043 2:71656076-71656098 GAAAGGAAACAAGAGAAGGAGGG - Intronic
932627570 2:73310365-73310387 GAGGGGAAATAAGAAGATGTTGG - Intergenic
932715032 2:74094582-74094604 GGGAGGGAATAAGAGGAAGGAGG + Intronic
932783319 2:74577753-74577775 CAGAGGAAATAAGAGGAAGCTGG - Intronic
932857036 2:75245819-75245841 GAGAGGGAAAACGAGGAGGGGGG - Intergenic
933440058 2:82301264-82301286 GAGAGGAAATGAGAGGATGTAGG - Intergenic
933476107 2:82792699-82792721 GAGAGGAAACAAGAGTGTTCGGG - Intergenic
933488659 2:82955954-82955976 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
933685905 2:85140963-85140985 GAGAGGGGACAAGAAGATCGAGG + Intronic
934670026 2:96206337-96206359 GAGAGGAAAGGAGAGTTTGGGGG - Intronic
934702089 2:96450702-96450724 GAGAGCAAAAAAGAGAAAGGAGG + Intergenic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935472633 2:103478635-103478657 GATAGGAAATAAGAGCATTGGGG - Intergenic
935635750 2:105248569-105248591 GAGAGGCAAGAGGAGGGTGGAGG + Intergenic
935675981 2:105595323-105595345 GAGAGGAAGGCCGAGGATGGAGG - Intergenic
936122498 2:109758944-109758966 GGGAAGAAAAAAGAGGAGGGAGG + Intergenic
936222195 2:110612528-110612550 GGGAAGAAAAAAGAGGAGGGAGG - Intergenic
936240961 2:110788459-110788481 TAGAGGTAACAAGAGGTTGGAGG + Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
937034864 2:118772580-118772602 GACAGGAAACAAGAGAAAGAAGG + Intergenic
937295666 2:120808389-120808411 GAGAGGTCACAGGAGGATGATGG - Intronic
937509793 2:122582922-122582944 GAGAGGAGAGGAGAGGAGGGGGG + Intergenic
937794244 2:125998204-125998226 GAGAGGTAAAAAGAGGGAGGTGG + Intergenic
938713169 2:133993026-133993048 GAGAGGAAAGAAGAGAGGGGTGG + Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939192314 2:138931394-138931416 GAGAGGAAAGAAGAGCAGTGTGG + Intergenic
939406577 2:141766012-141766034 GAGAGGAAACAAAAGCAATGGGG - Intronic
940156018 2:150658055-150658077 GAGAGGGAGCAAGAGGGTCGGGG - Intergenic
940258509 2:151757332-151757354 GTGAGGATACAAGAGGAAGATGG + Intergenic
940465159 2:154018540-154018562 GCGAGAAGATAAGAGGATGGGGG + Intronic
942115625 2:172726464-172726486 GACAGGAAACAGGAGATTGGAGG - Intergenic
942136865 2:172934881-172934903 GAAAGCAAACAAGAGGCCGGGGG + Intronic
942137501 2:172942344-172942366 GAGAGGAAGAAAGCAGATGGTGG - Intronic
942701368 2:178714862-178714884 GAGAGGAAACAAAGGGAAAGTGG + Intronic
942940745 2:181613148-181613170 GAGGGGAAGCAAGGGGATGATGG - Intronic
943089778 2:183360339-183360361 GAGGGCAAACAAGAGAATGAAGG - Intergenic
943090767 2:183372235-183372257 GGCTGGAGACAAGAGGATGGAGG - Intergenic
943278272 2:185896888-185896910 GAGAAGGAAGAAGAGGAGGGAGG + Intergenic
943361102 2:186920811-186920833 GGGAGAAATCAAGAGGTTGGGGG - Intergenic
943605001 2:189966535-189966557 AAGAGGAGGCAAGAGGAAGGTGG + Intronic
943760408 2:191601840-191601862 GAGAGGGAAAAAGAGAAGGGAGG - Intergenic
944301707 2:198131201-198131223 GTGTGAAAACAACAGGATGGGGG - Intronic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
945108988 2:206344769-206344791 GAGAGGGAACAAGGGGATGGGGG - Intergenic
945714002 2:213336045-213336067 GAGAGCAAAGAAGAGCATCGAGG + Intronic
946025521 2:216669704-216669726 GGGAGGAGACAAGAGTGTGGCGG + Intergenic
946174113 2:217912249-217912271 GGAAGGAAACAACAGGGTGGGGG + Intronic
946947582 2:224837504-224837526 GAGAGGAAAGAAAAAGATAGAGG - Intronic
947140210 2:227013550-227013572 GTGAGGACACAGGAAGATGGTGG + Intronic
947270124 2:228325473-228325495 GGGAAGAAACCAGAGGAAGGTGG + Intergenic
947394371 2:229672589-229672611 GAGAGGAAAAAGGATGAGGGAGG + Intronic
947589439 2:231377050-231377072 GGGAGGAAAGCAGGGGATGGAGG + Intergenic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
947820878 2:233068698-233068720 CAGAGGAGAGAAGAGAATGGGGG + Intronic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948138941 2:235658953-235658975 GGGAGGAAAGAGGAGGAGGGAGG - Intronic
948297718 2:236875336-236875358 GAAAGGAAAGGAGAGGGTGGGGG - Intergenic
948527106 2:238577873-238577895 GAGAGGGAACAAGAGAATGAGGG + Intergenic
948866317 2:240776527-240776549 AAGAGGCAGCAAGAGCATGGAGG - Intronic
1168867135 20:1096619-1096641 GGGAGGGAACATGAGGAGGGGGG - Intergenic
1169276216 20:4235339-4235361 TAGAGGATGCAAGAGGATGCGGG - Intronic
1169300154 20:4435231-4435253 GAGAGGAAGAAAGAGAAAGGGGG + Intergenic
1169334295 20:4742679-4742701 GAGAGGAGGCAAGAGGAGGGAGG - Intergenic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1170003821 20:11644991-11645013 GTGAGGATACAAGGGGAAGGCGG + Intergenic
1170496510 20:16930505-16930527 GAGAGGAAAGAAGAGCAGTGTGG + Intergenic
1171173909 20:23036993-23037015 GAGAGGACTCAAGAAGGTGGAGG + Intergenic
1171491415 20:25521070-25521092 GGGAGGAAACAAGTGAATGCTGG - Intronic
1171818283 20:29808620-29808642 GGGAGGAAACAAGGGGATAGTGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172785468 20:37465472-37465494 GAGAGGAGAGAAGAGGAGGAAGG - Intergenic
1172917886 20:38457464-38457486 GAGGGGATACCAGAGAATGGGGG - Intergenic
1173439593 20:43064245-43064267 GATGGGAAACTAGAGGGTGGAGG - Intronic
1173677065 20:44845110-44845132 GAGAAGAGACAAGAGAATGGGGG - Intergenic
1173996861 20:47345305-47345327 GGAAGGAACCAAGAGGAAGGAGG + Intronic
1174559417 20:51419422-51419444 GATGGGAAAAAAGAGGAAGGAGG - Intronic
1175478233 20:59292153-59292175 AAGATGAAACAAGAGAATGCGGG + Intergenic
1175676384 20:60949838-60949860 GAGAGGAGAGGAGAGGAGGGAGG + Intergenic
1175853152 20:62104503-62104525 GAGAGGAAACCAGGGGATGTTGG + Intergenic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176590387 21:8643693-8643715 TCCAGGCAACAAGAGGATGGAGG - Intergenic
1178105186 21:29310633-29310655 AAGAAGAAACCAGAGGATTGTGG + Intronic
1178151004 21:29793541-29793563 GAGAGGAATAAACAGGAAGGGGG - Intronic
1178882934 21:36462980-36463002 GAGAGGGAAGAAGAGGAGGGAGG + Intronic
1179084989 21:38207980-38208002 GGGAGGAAAGAAGAGGAGAGAGG - Intronic
1179150581 21:38805663-38805685 GAGGGGAGAGAAGAGGAGGGCGG - Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1180273217 22:10620726-10620748 TCCAGGCAACAAGAGGATGGAGG - Intergenic
1180321725 22:11328028-11328050 GGGAGGGAACAAGGGGATAGTGG - Intergenic
1180333330 22:11552640-11552662 GGGAGGGAACAAGGGGATAGTGG + Intergenic
1180749674 22:18115609-18115631 GACAGGAATGAAGGGGATGGGGG + Intronic
1180911273 22:19452491-19452513 CAGAGGAAACTAGAAGATAGTGG - Intronic
1181330406 22:22086556-22086578 GAGAGGAAACCAGACCATGCTGG - Intergenic
1181685001 22:24522276-24522298 AAGATGAACCAAGAGGATGTGGG + Intronic
1181927343 22:26370568-26370590 GAGAAGAAAGAAAGGGATGGAGG - Intronic
1182403090 22:30098393-30098415 GAGAGGAAAAGAGAGTATGTGGG + Intronic
1182822817 22:33233432-33233454 GAGAGAGGACAAGAGGAAGGAGG - Intronic
1182946505 22:34327751-34327773 GAGAGGAAGCAAGAGCAAGACGG - Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1184313493 22:43664500-43664522 AACAGGAAACAAGATGAAGGAGG + Intronic
1184320719 22:43740214-43740236 GAGAGAAGATAAGAGGATTGGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184635146 22:45822087-45822109 GACAGGAAACAAAAGAATGCAGG - Intronic
1184671969 22:46017847-46017869 GAGAAAAAAGAAGAGAATGGCGG - Intergenic
1184673000 22:46025421-46025443 GAGAGGGAGCAAGAGGGTGCAGG - Intergenic
1184856313 22:47148632-47148654 GAGAGGAACCCAGGGGAGGGAGG - Intronic
1184856359 22:47148742-47148764 GAGAAGAACCCAGAGGAGGGAGG - Intronic
949136891 3:577982-578004 TCCAGGCAACAAGAGGATGGAGG + Intergenic
949177192 3:1079219-1079241 TAAAGGAAACTAGAGGCTGGTGG + Intergenic
949656873 3:6231072-6231094 GAGAGGGAAGAAGAGAATGAGGG - Intergenic
949688097 3:6600929-6600951 GAAAGGATGCCAGAGGATGGCGG + Intergenic
950099232 3:10346949-10346971 GAGAGGAAACAAAGTGATGCTGG - Intronic
950159611 3:10750269-10750291 GTGAGGGAACATGAGGATGGTGG - Intergenic
950167799 3:10814875-10814897 GAGGGGAAACGGGAAGATGGTGG + Intergenic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
951007042 3:17629740-17629762 GACAGGCAACAAGAAAATGGGGG + Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951601406 3:24380180-24380202 GAGAGGGAGAAAGAGGATGATGG - Intronic
951951337 3:28202567-28202589 GAGAGGAAAAAAGAGCAGTGTGG + Intergenic
951996730 3:28738048-28738070 GAAAGGAAGGAAGAGGATGAGGG + Intergenic
952786192 3:37157556-37157578 GAGAGGGGAAAAGAGGAAGGAGG + Intronic
953481968 3:43259554-43259576 GAGAGGACACTAAAGCATGGAGG - Intergenic
953911070 3:46893320-46893342 GAGAGAGAAAGAGAGGATGGAGG - Intronic
955628426 3:60946115-60946137 GTGAGGATACAGGAGGATGACGG + Intronic
955810695 3:62785322-62785344 GAGATGAAACATGATCATGGTGG - Intronic
955827317 3:62962190-62962212 GACAGGAGAGAAGGGGATGGGGG + Intergenic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
956657560 3:71567049-71567071 GATAGGAAAAAAGAGGCTGATGG + Intronic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
959516165 3:107269484-107269506 GAGAGGAAGCAAGAGTGGGGAGG - Intergenic
959623242 3:108421692-108421714 GAGAGGTAAGAAGGGGAAGGAGG + Intronic
959672717 3:108997207-108997229 AAGAGGAAACAAGAAGAATGTGG + Intronic
959912541 3:111779803-111779825 CAAAGGCAAAAAGAGGATGGAGG - Intronic
960203823 3:114870871-114870893 GACAGGAAAAATGAGGAGGGAGG - Intronic
960236721 3:115291870-115291892 GAGAGTGAAACAGAGGATGGGGG + Intergenic
960722429 3:120638062-120638084 GAGAGCAAGCAAGAGAAAGGAGG - Intronic
960854647 3:122090765-122090787 GAGAGGAAGAAAGAAGATAGAGG + Intronic
961625946 3:128263903-128263925 AAGAAGAAACAAGGGGATGTGGG - Intronic
961917510 3:130392595-130392617 GGAAAGAAACAAGAGGAAGGAGG - Intronic
962101456 3:132347003-132347025 AAGAGGAAACATGAGGAAAGTGG - Intronic
962415333 3:135176968-135176990 AAGAGGAAGCAAGCGGAGGGTGG - Intronic
962694086 3:137930498-137930520 GAGAGAAAGAAAGAGGAGGGAGG + Intergenic
963472551 3:145760249-145760271 GCCAGGAAGGAAGAGGATGGTGG + Intergenic
963537791 3:146549754-146549776 GAGAGGAGAGAACAGGAAGGTGG + Intergenic
963783541 3:149510589-149510611 GGAAGGAAAGAAGAGGAGGGAGG - Intergenic
964081173 3:152759845-152759867 GAGAGGAGACAAGTGGAGAGTGG - Intergenic
964323322 3:155520308-155520330 GATAGGAAAAAAGATGAGGGAGG + Intronic
964639282 3:158891531-158891553 GTGAGGATACAAGAAGATGTTGG - Intergenic
964728895 3:159844099-159844121 GAAATGACACAAGAGGAAGGGGG - Intronic
964969507 3:162542265-162542287 AAGAAGGAACAAGGGGATGGAGG - Intergenic
965183851 3:165437992-165438014 GAGAGGAAAATGGAGGATGTAGG - Intergenic
965219091 3:165903293-165903315 GAGAGGAAACAAAAGTAAGTAGG + Intergenic
965855268 3:173080513-173080535 GAGAGGAAGGATGAGGATGACGG + Intronic
966271484 3:178112468-178112490 GAGAGGGAGCAAGACGGTGGAGG - Intergenic
967345620 3:188452368-188452390 GAAAGGAAACAAGAGGAGGTGGG - Intronic
967514556 3:190351113-190351135 GAGAGGGACCAAGGGGGTGGGGG - Intronic
967842145 3:194014645-194014667 GAAAAGAAACAAGAAGAGGGAGG + Intergenic
970058139 4:11999108-11999130 GAGAGGAAGCAAGAGGGAGGGGG + Intergenic
970374804 4:15446366-15446388 GAGAGGGATCAAGAGAGTGGGGG + Intergenic
970402952 4:15735405-15735427 TAGAGGAAAACAGAGGGTGGGGG + Intronic
970472043 4:16388739-16388761 TAGAGGAAAGCAGAGGCTGGGGG - Intergenic
970737515 4:19191903-19191925 GAGAGAAAAGAAGAGGAGTGGGG + Intergenic
971082591 4:23231519-23231541 CAGAAGAAACACGAGGTTGGTGG + Intergenic
971253481 4:24992774-24992796 GAGGGGACACAAGAGGGTGAGGG - Intergenic
972127747 4:35790208-35790230 GAGAGGGAAGGGGAGGATGGGGG + Intergenic
972194513 4:36637279-36637301 GACAGAAAACAATAGGATGCAGG + Intergenic
972341677 4:38157493-38157515 GAGAGGAAGCAAGGGGAGGGAGG + Intergenic
972604706 4:40603549-40603571 GAGGGGAAAGGAGAGGAGGGAGG - Intronic
972722426 4:41713586-41713608 GAGAGGGAGCAAGAGGGAGGGGG + Intergenic
973604292 4:52571227-52571249 GAGAAGGAACAGCAGGATGGAGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974202077 4:58655530-58655552 CATAGAAAACAAGAGGATGGAGG - Intergenic
974362649 4:60902341-60902363 GGGAGGAAACAAGGAGATGTAGG - Intergenic
974404054 4:61442560-61442582 GAGAGGTAATAAGAGGAAGAAGG + Intronic
974821674 4:67074363-67074385 GAAAGGGAACAAGAGGCTGAGGG + Intergenic
975075696 4:70206002-70206024 GAGAGGAGAAAAGAGGACTGAGG - Intergenic
975370906 4:73586255-73586277 GAGAAGAAATAATAGGATAGTGG - Intronic
975406726 4:73998784-73998806 GTGTGGAAAGAAGAGGTTGGGGG + Intergenic
975607401 4:76168869-76168891 GAGAGCTAAGAAGAGGGTGGTGG + Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
977313392 4:95414270-95414292 GATAAGAAAAAAGAAGATGGAGG + Intronic
978111628 4:104971266-104971288 GAGAGGAAAAGAGAGTTTGGCGG - Intergenic
979770607 4:124520617-124520639 GACAGAAAACATGAGGATGATGG - Intergenic
979884302 4:126005275-126005297 GAGAGTTAAAAAGAGAATGGGGG - Intergenic
980042362 4:127953910-127953932 GAGAGAAAACAGGATGATTGGGG + Intronic
980082106 4:128355076-128355098 GAGAGGCAGCAAGAGGAAGGAGG - Intergenic
980189269 4:129502587-129502609 AAGAGAAACCAAGAGGTTGGAGG + Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980626566 4:135381121-135381143 GAGAGGAAAAAAGAGCAGTGTGG - Intergenic
980787515 4:137573366-137573388 GAGAGGAAAGAAGAGCAGCGTGG - Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981223917 4:142269290-142269312 GAGAGGAAAAAAGAGGGGGGAGG - Intronic
981420966 4:144549870-144549892 GAGAGGCAACAAGAGAAAGAGGG + Intergenic
981616089 4:146646485-146646507 GAGAGGAAGAGAGAGGAGGGAGG - Intergenic
982116838 4:152105119-152105141 GAGAGAATGCAAGAGGGTGGAGG + Intergenic
982144791 4:152374227-152374249 GAGAAGAAAGAATAGGGTGGTGG - Intronic
982157479 4:152536152-152536174 GAGCGGAAAGAAGAGGGAGGGGG - Intergenic
982664337 4:158243159-158243181 GAGAGGAAACAATAGAACAGAGG - Intronic
982694278 4:158581956-158581978 GAGAGGAAGCAAGAGAGAGGAGG + Intronic
982905407 4:161063144-161063166 GAGAGGGTAAAAGAGGAAGGAGG - Intergenic
983057225 4:163112448-163112470 GAGAGGAAACACATGGATGGAGG + Intronic
983939849 4:173527484-173527506 GAGAGGAAAGGATACGATGGGGG + Intronic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
985771977 5:1817519-1817541 GAGAGGGAAGAAGGGGATGCAGG + Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
986454165 5:7899045-7899067 GAGAGGGAGCAAGAGGCAGGGGG + Intronic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987151183 5:15041800-15041822 GAGAGGAAATAGGAAGATGTAGG - Intergenic
987432245 5:17849163-17849185 AAGAGGAAAGAAGGGGAGGGAGG - Intergenic
988434876 5:31162680-31162702 TAGAGGAAACAATAGAATTGGGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988676795 5:33441017-33441039 GAGAGGAGCCAAGAGGCGGGTGG - Exonic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
989042025 5:37239150-37239172 AAGAGGAAAGAAGAGCATTGTGG - Intronic
989220827 5:38960774-38960796 GAGAGGAGATAAGATTATGGGGG + Intronic
989274151 5:39567168-39567190 GAAAAGAAAGAAGAGGAGGGAGG + Intergenic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
989502136 5:42179873-42179895 GAGAGGAAAGAGGGGCATGGAGG + Intergenic
989619675 5:43371998-43372020 GAGAGGAAGCAAGAGAGTGGGGG + Intergenic
989676786 5:43982011-43982033 GAGAGGAAGGAAGAGCAGGGTGG - Intergenic
990068431 5:51748070-51748092 GAGAGGGAACGAGAGGATAGAGG + Intergenic
990118371 5:52417718-52417740 TAGAGGACACAGGTGGATGGGGG - Intergenic
991226402 5:64278173-64278195 AAGAGGAAGGAAGAAGATGGTGG + Intronic
991391190 5:66144824-66144846 GGGGGGAAATAAGAGGGTGGGGG - Intronic
992135281 5:73738043-73738065 GAGAAGAGACAAGACAATGGAGG + Intronic
992155414 5:73950583-73950605 GACAGGAGACAGGAGGGTGGGGG + Intergenic
992543016 5:77783039-77783061 GACAGGAAACAGGAGAATAGGGG + Intronic
993069684 5:83144662-83144684 AAAAGGAAAAAAGAGAATGGAGG - Intronic
993161626 5:84298827-84298849 GAGAGGAACCCTGTGGATGGTGG - Intronic
993417141 5:87648941-87648963 GAGAGGAAAGAACTTGATGGCGG + Intergenic
993501702 5:88673825-88673847 GAGAGGAAAGAAGGGGAAGAAGG - Intergenic
993511483 5:88776634-88776656 GAGAGGAAAGAAAGGGAGGGAGG + Intronic
993733557 5:91449621-91449643 GAGAGGAAACAAGACAGTGTTGG + Intergenic
994223802 5:97228639-97228661 GAGAGGACAGGAGAGGGTGGAGG + Intergenic
994225507 5:97247829-97247851 GAGAGGAAATAAGGGGAAGAAGG + Intergenic
994669630 5:102751583-102751605 TAGAGGAAACAAGCGGGGGGCGG + Intergenic
995266079 5:110162458-110162480 GAGAGAAAACGAGAAGATGTAGG + Intergenic
995316675 5:110782441-110782463 GAGAGGAAGCAAGAGGGGGTGGG + Intergenic
995741984 5:115365100-115365122 GTGAGGGAACAAGAGAAGGGAGG - Intergenic
995782182 5:115789299-115789321 GAGAGGGAGCAAGGGGGTGGGGG - Intergenic
997153297 5:131523597-131523619 GAGAGGAAAAAAGGTGAAGGTGG + Intronic
997445864 5:133939732-133939754 GAGAGGTAACAGGATCATGGGGG + Intergenic
997905401 5:137811569-137811591 GAGAGGAAGCAAGAGAGAGGAGG - Intergenic
998859594 5:146429293-146429315 GAGAGAAAGAAAGAGGTTGGGGG - Intergenic
999469920 5:151844964-151844986 GAGAGGAAGCAAGAAGTGGGTGG + Intronic
999656805 5:153818541-153818563 GACTGGACACAAGAGGATGATGG - Intergenic
999921092 5:156321901-156321923 CTAAGGAAAAAAGAGGATGGGGG - Intronic
999995851 5:157091538-157091560 GAGCAGAAACTAGATGATGGTGG + Intronic
1000644398 5:163743247-163743269 GGGAGGAAACAAAAGGAGGCAGG + Intergenic
1000856454 5:166404042-166404064 GAGAGAAAAGAAGAAGAGGGGGG - Intergenic
1001171842 5:169426888-169426910 AAGAAGAAGCAAGAGGGTGGGGG + Intergenic
1001485320 5:172115619-172115641 GAGAGGCGACAAGAGGGTAGTGG + Intronic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001666259 5:173435891-173435913 CAGAGCAAAAAAGAGGGTGGAGG - Intergenic
1001797209 5:174512662-174512684 GATGGGAACCAAGAGGCTGGTGG + Intergenic
1002257475 5:177968797-177968819 GAGAGGAAGCAAGAGGGTCCAGG + Intergenic
1002606457 5:180385592-180385614 GAGAGGAAATAAGAGGGAAGTGG + Intergenic
1002742675 5:181444927-181444949 GAGAAGAAAGGAGAGGAGGGTGG + Intergenic
1002924538 6:1597367-1597389 GAGAATTAACATGAGGATGGGGG - Intergenic
1003568344 6:7239399-7239421 GAGAGGAAAAGAGAGGAGGAGGG - Intronic
1003673460 6:8181322-8181344 GAGAGGAAAGTAAAGGAGGGAGG - Intergenic
1003802180 6:9682379-9682401 GGGAGGAAAGCAGAAGATGGAGG + Intronic
1003821686 6:9905234-9905256 CAGAAGAAACAAGAAGATGCGGG - Intronic
1003906793 6:10708180-10708202 GGGGGGAAAGGAGAGGATGGGGG - Intronic
1004082201 6:12405877-12405899 GAGAGGAATCAAGAGGTAGCGGG + Intergenic
1004588257 6:17024319-17024341 GAGAGGAAGCAAGAAGAGGGAGG - Intergenic
1005049677 6:21673309-21673331 GAGAGGAAAGAGGAATATGGCGG + Intergenic
1005222429 6:23601905-23601927 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1005230432 6:23695625-23695647 GGGAGCAAAGAAGAGAATGGTGG - Intergenic
1005272950 6:24185857-24185879 GAGAGGAGTGAAGGGGATGGAGG - Intronic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1005824475 6:29624490-29624512 GGGAGGAAACAAATGGAAGGTGG - Intronic
1006395954 6:33788081-33788103 GGGAGAAAACCAGAGGTTGGAGG + Intronic
1007308873 6:40929174-40929196 GAAAAGAACCAAGAGAATGGGGG + Intergenic
1007323172 6:41041477-41041499 GTCAGGAGAAAAGAGGATGGGGG + Intronic
1007593717 6:43038733-43038755 GAGTGGAGAGAAGAGGATGGAGG + Intronic
1008067835 6:47069401-47069423 AGGAGGAAAAAAGAGGATGGCGG - Intergenic
1008458342 6:51738345-51738367 GAGAGGAAATGAGGGGATGTTGG + Intronic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008819020 6:55608924-55608946 GAGAGGAGAGAAGAGCAAGGTGG + Intergenic
1008863219 6:56176867-56176889 GGGAGGAAAGAGGAGGAAGGGGG + Intronic
1009613629 6:65977783-65977805 GAAAGGAATCTGGAGGATGGAGG + Intergenic
1009925168 6:70112169-70112191 GAGGTCAAACAAGGGGATGGAGG + Intronic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010531871 6:76978376-76978398 GAGAGGAAGCAAGAGGCAGTGGG - Intergenic
1010598434 6:77793650-77793672 GAGAGGAAAGAAGAGGTTAGAGG + Intronic
1010616335 6:78016621-78016643 GAGAGAAAACAAGAGAATCAGGG - Intergenic
1010865263 6:80968588-80968610 AAGAGAAAATAAGAGGATGTAGG - Intergenic
1011261242 6:85471995-85472017 GAGAGAAAAAAAGAGAGTGGTGG - Intronic
1011312570 6:85996503-85996525 GAGAGAAAAGAAGAGGCTTGAGG - Intergenic
1011554099 6:88556875-88556897 GAGAGGAGAGGAGAGGGTGGTGG + Intergenic
1011782659 6:90807664-90807686 AACATGAAAAAAGAGGATGGTGG + Intergenic
1011873386 6:91925541-91925563 GAGAGGAAAGAAGAGGACCTGGG - Intergenic
1012071680 6:94627320-94627342 GTGAGGAAACAAGAAGATCCTGG + Intergenic
1012092770 6:94919541-94919563 GAGAGGAAAAAATAGTATGTGGG - Intergenic
1012300291 6:97578860-97578882 GAAAGGAAACAAGATAATGAAGG - Intergenic
1012427519 6:99130778-99130800 GAGAGGAAAAGAGAAGAGGGAGG - Intergenic
1012670085 6:102033373-102033395 GAGAGGAAGCAAGAGCATGCTGG - Intronic
1012704016 6:102498528-102498550 ATGAGGAAACTAGAGGATAGAGG - Intergenic
1012794423 6:103741347-103741369 GAGAGAAAAGAAGAGAAGGGAGG + Intergenic
1012953982 6:105548730-105548752 GTGAAGAAAAAAGAGGATCGGGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013052225 6:106547527-106547549 GAGATGAGCCAAGATGATGGAGG + Intronic
1013447746 6:110248072-110248094 GAGAGGGAACAAGAGAGAGGGGG - Intronic
1014194356 6:118535597-118535619 GAGAGGAAACAAAATGGTGTGGG - Intronic
1014422218 6:121260502-121260524 GAGAGGAAGGAAGAGCAGGGTGG + Intronic
1014676966 6:124379101-124379123 GAAAGGAAAGAAGAGGAGAGGGG + Intronic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015699472 6:136019902-136019924 GAGAGGGAGGAAGAGGAAGGGGG + Intronic
1015882554 6:137883608-137883630 AAGAGAAAACAAGAGGGAGGAGG + Intergenic
1016359922 6:143256333-143256355 GAGAGAAAACAAGAGGTTGGAGG - Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016836567 6:148483233-148483255 GAGAAGAAACAAGAGGGAGAGGG + Intronic
1017350113 6:153430507-153430529 GAGAGGAAGCAAGAGAGTGGGGG - Intergenic
1017445813 6:154506300-154506322 GAGAGGAAAGGGGAGGAAGGAGG + Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017614839 6:156234709-156234731 GAGAGGAAGAAAGAGGAAAGAGG + Intergenic
1017687317 6:156926604-156926626 GAGGTGAAACAAGATGAAGGTGG - Intronic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1018082602 6:160271296-160271318 GAGAGGCAACAAAAGGAAGGAGG - Intronic
1018766387 6:166936574-166936596 GAGAGGAAGCCAGGGGTTGGGGG + Intronic
1018920672 6:168170350-168170372 TAAAGGAAAAATGAGGATGGAGG - Intergenic
1018925550 6:168204296-168204318 TAGAGGATACAGGGGGATGGGGG + Intergenic
1018945061 6:168342095-168342117 GAGTGGACACGAGAGGCTGGAGG - Intergenic
1019013344 6:168860926-168860948 GAGAGGGAGAAAGAGGAAGGGGG + Intergenic
1019198059 6:170293709-170293731 GAGAAGGAAGAAGAGGAAGGAGG - Intergenic
1019247810 6:170720666-170720688 GAGAAGAAAGGAGAGGAGGGTGG + Intergenic
1019635762 7:2074820-2074842 GAGGGGAAACCGGAGGCTGGGGG + Intronic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020266347 7:6562841-6562863 GAGAGGAAAAAACGGCATGGCGG - Intergenic
1020672218 7:11130589-11130611 CAGAGGAAACTAGGGGAAGGAGG - Intronic
1021362095 7:19728180-19728202 GAGAGAAAGAAAGAGGAGGGAGG - Intronic
1021377438 7:19925173-19925195 AAAAGGAAACAAGAGGTTGTAGG + Intergenic
1022384248 7:29887055-29887077 GACATGAGACACGAGGATGGCGG + Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022636669 7:32142645-32142667 GAGAGAAAAAGAGAAGATGGTGG - Intronic
1022663795 7:32389935-32389957 GAGAGAAGACATGAGGATGAAGG - Intergenic
1023623573 7:42095685-42095707 GAGAGGACACAAGAGGAGGGAGG + Intronic
1023672120 7:42588083-42588105 GAGAGGAAACAAGAGAATCGAGG - Intergenic
1023745212 7:43316819-43316841 GAGAGGAAAGAAGAGAGTAGAGG - Intronic
1023914459 7:44578278-44578300 GAGATGAAATAAGAGGTTGTGGG - Exonic
1024346199 7:48316775-48316797 GAGAGGAAGCAAGAGGGGGGAGG + Intronic
1024999561 7:55303694-55303716 GAGGGGAAGGAAGAGGAGGGAGG + Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026284903 7:68954662-68954684 GAGAGGGAAAAAGAGGGAGGGGG + Intergenic
1026306450 7:69146344-69146366 GAGAGAAAAAAAGAAGAGGGAGG - Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026554210 7:71391943-71391965 GAGAGGGAACAAGAGAGTGGTGG + Intronic
1026638775 7:72106561-72106583 GAGAGAGAAAAAGAGGAAGGTGG + Intronic
1026652698 7:72229330-72229352 AAGAGGAAAGCAGAGCATGGTGG + Intronic
1026837559 7:73648500-73648522 GAGAGGGAAAGAGAGGAAGGGGG - Intergenic
1026877983 7:73890622-73890644 GAGAGGAGACGGGAGGAAGGAGG - Intergenic
1026996091 7:74617619-74617641 GAGAGGAAATAGGAGCAGGGAGG - Intergenic
1027543652 7:79499895-79499917 GAGAGCAAGCAAGAGAAAGGAGG - Intergenic
1027545947 7:79527861-79527883 GAGAAGGAAGAAGAGGAGGGAGG - Intergenic
1028028244 7:85874427-85874449 GAGAGTCAACAAGAGCAAGGAGG - Intergenic
1028272060 7:88803859-88803881 GAAAGGAAAGAAGAAGGTGGAGG + Intronic
1028396248 7:90371576-90371598 GATAGGAAACAAGATGGTAGGGG + Intronic
1028471587 7:91212209-91212231 TAGAAGAAAGAAGGGGATGGAGG + Intergenic
1028598814 7:92578477-92578499 GAGAGGTATTAAGAGGATGGAGG - Intronic
1028798267 7:94930174-94930196 GAGAGGAAACATGAGAATAAGGG + Intronic
1028827596 7:95291212-95291234 GAGAGGAAACCTGAAAATGGTGG - Exonic
1029296659 7:99545480-99545502 AAGAGGAAGCAAGGCGATGGCGG + Intergenic
1029872079 7:103705010-103705032 GAGAAAAATCAAGAGGGTGGTGG - Intronic
1030195494 7:106849274-106849296 GAAAGACAGCAAGAGGATGGGGG - Intergenic
1030944518 7:115700343-115700365 GAGAGGAGACAAGAGGAAGGCGG - Intergenic
1031901298 7:127414519-127414541 GAGAGGAAACACAAGAGTGGAGG - Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032390876 7:131554859-131554881 GAGATGACACGAGAGTATGGTGG - Intronic
1033537930 7:142329023-142329045 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033537948 7:142329088-142329110 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033542249 7:142367761-142367783 GAGAGGAAATTAGAGGTTGGAGG - Intergenic
1033551488 7:142451871-142451893 GAGAGAAAACATGAGGGTGGGGG - Intergenic
1034152153 7:148925478-148925500 GAGAGGCAACATGAGGACGGGGG + Intergenic
1034281890 7:149860378-149860400 CAAAGGGAACAAGAAGATGGTGG + Exonic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034405112 7:150897748-150897770 AAGAGGAAACCAGAAGATGTCGG + Intergenic
1034507145 7:151501862-151501884 AAGAGGAGGCAAGAAGATGGTGG + Intronic
1034555759 7:151849445-151849467 GACAGGAGACCAAAGGATGGAGG + Intronic
1034627847 7:152507152-152507174 GAGAGATAACATGGGGATGGTGG + Intergenic
1034727792 7:153355853-153355875 GAAAGGAAACTAGAGGGTGTTGG + Intergenic
1035500307 8:87198-87220 GAGAAGAAAGGAGAGGAGGGTGG - Intergenic
1035731647 8:1857709-1857731 GAGAAGAAACAAGAGGCTGGGGG - Intronic
1035984531 8:4412283-4412305 GAGAGCAACCGAGAGGATGGTGG - Intronic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036482073 8:9148853-9148875 GAGAGAGAATAAGAGAATGGAGG - Intronic
1036611977 8:10358375-10358397 GGGGGGAAACAAGAGAATAGAGG - Intronic
1037027186 8:14053505-14053527 GAGAGGACATAAGAGGACAGTGG + Intergenic
1037151248 8:15637828-15637850 GAGAGGAAGAAATAGGAGGGAGG - Intronic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037844650 8:22272481-22272503 GAGAGGAAGCAAGAGAGGGGAGG - Intergenic
1037938563 8:22931788-22931810 GAGAAGTAACAAGAGGGTAGAGG - Intronic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1038825185 8:30991597-30991619 GAGAGGAGGAAAGAGGAGGGAGG - Intergenic
1039130343 8:34256976-34256998 GAGAGGAGAGAAGAGGAGAGGGG - Intergenic
1039583883 8:38689126-38689148 GACAGGAGAGAAGAGAATGGAGG + Intergenic
1040094511 8:43430983-43431005 GAGAGGAGACATGATGGTGGTGG - Intergenic
1041366799 8:57114940-57114962 GAGAGGAAATGAGATGATGCAGG + Intergenic
1041775866 8:61522420-61522442 GTGAGGACACAAGAAGAAGGTGG - Intronic
1042397794 8:68311803-68311825 GAGAAGGAAGAAGAGGAGGGGGG - Intronic
1042953395 8:74223920-74223942 GAGCTGAAACAACAGGAAGGAGG + Intergenic
1043276283 8:78399190-78399212 GGAAGGAATGAAGAGGATGGTGG - Intergenic
1043817697 8:84823412-84823434 GAGAGGAAATAAAAGGCTGCAGG + Intronic
1044516364 8:93143317-93143339 GAGAGAAAGAAAGAGGAAGGAGG - Intronic
1044743025 8:95346909-95346931 GAGAGGAAAGGAGAGGAAAGGGG - Intergenic
1044888349 8:96804316-96804338 GTGAGGAAAGAAGGGGAGGGAGG + Intronic
1045458816 8:102409215-102409237 GGGTGGAAAGAAGAGGATGTTGG - Intronic
1045734296 8:105277010-105277032 GAGACAAAACTGGAGGATGGTGG - Intronic
1045820165 8:106327978-106328000 GAGGGGAAACTAAAGGATGTGGG + Intronic
1046053498 8:109052071-109052093 GTGAGGAAGAAAGAGGATAGAGG - Intergenic
1046068927 8:109226930-109226952 GAGAGGGAACAAGAGAAAGGAGG - Intergenic
1046161366 8:110370146-110370168 GAGAGAAAAAAAAAAGATGGAGG - Intergenic
1046611719 8:116432957-116432979 GAAAGAAAAAAAGAGGAGGGCGG + Intergenic
1047331444 8:123892262-123892284 AATGGGAAAAAAGAGGATGGAGG + Intronic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047673565 8:127174786-127174808 GAGAGGAAGCAAAAGGGAGGGGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048080841 8:131124587-131124609 GAGAGGACACGTGTGGATGGAGG + Intergenic
1048340645 8:133536204-133536226 GAGAGCACACATGAGGCTGGGGG + Intronic
1048699607 8:137074223-137074245 GAGAGAAAGCAAGAGGAATGGGG - Intergenic
1049026010 8:139989404-139989426 GAGAGGAAACAAAAGAGTAGAGG - Intronic
1049034124 8:140061295-140061317 GAGAGGACACAACAGGCTGCCGG - Intronic
1049535750 8:143180922-143180944 GAGAGGAGAGAACAGGGTGGGGG - Intergenic
1049583154 8:143421766-143421788 GAGAGGAGACCAGAGGCTGCAGG + Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1050044278 9:1527138-1527160 GAGGGGAAATAAGAAGAGGGAGG + Intergenic
1050409499 9:5348065-5348087 GGGAGGAAATAAGAAGATGCAGG + Intergenic
1050870579 9:10563993-10564015 GAGAGAAAAAAAGAGGATGTAGG - Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051632291 9:19151439-19151461 GAGAGGAAAGGAGAGAAGGGTGG + Intergenic
1051762812 9:20486820-20486842 GAGAATAAACAAGCTGATGGAGG - Intronic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052404156 9:28038293-28038315 GAGAAAAAAGAAGAGGATGTGGG + Intronic
1052706653 9:32001389-32001411 GAGAGGAGACAAGTGGAAGAGGG + Intergenic
1052916259 9:33926313-33926335 GAGAGAAAACAAGATGGAGGAGG + Intronic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1055591193 9:77815993-77816015 TAGAGGAAACTAGAGGAAGGTGG + Intronic
1055679027 9:78695514-78695536 GGGAGGAAAGAAGAGGAGGAAGG + Intergenic
1055803064 9:80061772-80061794 GAGTGGTAACTAGAGGAAGGCGG + Intergenic
1055824505 9:80307155-80307177 GAGGGGAAAGGAGAGGAGGGAGG - Intergenic
1055912471 9:81368213-81368235 GAGAGGAGAGAAGAGGAAAGGGG + Intergenic
1055928099 9:81531467-81531489 GGGAGGAAACAGGAGGAAGCTGG + Intergenic
1056146004 9:83729939-83729961 GAGAGGAAAGAAGAGGAAAAAGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056539599 9:87559910-87559932 GAGACAAAAGAAGCGGATGGAGG - Intronic
1056551560 9:87657378-87657400 GAGAGGAACCAAGAGTCTTGAGG - Intronic
1057596013 9:96417273-96417295 GAGAGGAAACGAGAGGGATGAGG - Intronic
1058139283 9:101340904-101340926 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1058328536 9:103728419-103728441 GAGAGGGAACAGGAGGGTGATGG - Intergenic
1058481091 9:105396006-105396028 TACAGGAACCTAGAGGATGGGGG - Exonic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058755806 9:108082214-108082236 GGAAGGAAACAAAAGTATGGTGG - Intergenic
1059107491 9:111524367-111524389 AAGAGGAAACAAGAGTAAGGTGG + Intergenic
1059233200 9:112740438-112740460 GAGAGGAAGCAAGAGAGAGGAGG - Intergenic
1059343265 9:113611691-113611713 GAGAGGACACACTGGGATGGTGG + Intergenic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1059826712 9:118038025-118038047 AAGAGGATGCAGGAGGATGGGGG + Intergenic
1060107744 9:120884513-120884535 GAGAGCAAATAAGAAGATAGTGG + Intronic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060438222 9:123614634-123614656 GAGAGGAAACAAGGGAGAGGCGG + Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1061222667 9:129261249-129261271 GTGAGGAAAGAAGAGGCTTGGGG - Intergenic
1061240627 9:129369578-129369600 GATAGCAAAAAAGAGGAGGGAGG - Intergenic
1061375666 9:130222960-130222982 GAGGGGAAAGAAGAGGGGGGCGG + Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1203608582 Un_KI270748v1:76146-76168 GAGAAGAAAGGAGAGGAGGGTGG + Intergenic
1203620396 Un_KI270749v1:122358-122380 TCCAGGCAACAAGAGGATGGAGG - Intergenic
1185485983 X:481988-482010 GAGAGGAAGGAAGGAGATGGAGG + Intergenic
1185623894 X:1469148-1469170 GAGAGGAAAGGAGAGGAGAGAGG - Intronic
1185683973 X:1911692-1911714 GAGAGGAAGAGAGAGGAGGGAGG - Intergenic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186879448 X:13850295-13850317 GAGAGGAAGCAAGAGAAAGAGGG - Intronic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187319440 X:18226799-18226821 GAGTGGAAACAAGTGGAGAGTGG - Intergenic
1187511464 X:19923410-19923432 GAGGGAAAACAAGTGGTTGGGGG + Intronic
1187566932 X:20460059-20460081 GAGAGTTGACAAGAGGATGTAGG + Intergenic
1188386116 X:29561081-29561103 AAGAGGAAACAAGAGGAGTGGGG - Intronic
1188475373 X:30586387-30586409 GAGAGGAAGCAACAGAAGGGAGG + Intergenic
1188475733 X:30589668-30589690 GAGAGAAAGCAAGAGGTGGGAGG + Intergenic
1188895709 X:35665883-35665905 GGGAGGAAAAAAGAGGTAGGAGG - Intergenic
1189214873 X:39314340-39314362 GAGAGGAAGAAAGAGAAGGGAGG + Intergenic
1189911286 X:45812846-45812868 GAGCAGAAAGAAGAGGAGGGAGG + Intergenic
1190107735 X:47571658-47571680 AAGAGGAAACCAAATGATGGAGG - Exonic
1190113212 X:47608622-47608644 GAGAGGGAGCAACAGGAGGGAGG + Intronic
1190274311 X:48890676-48890698 GAGAGACACCAAGAGGATGCAGG + Intergenic
1190477044 X:50838958-50838980 GAGAGGAAACATGAGACTTGTGG - Intergenic
1190596197 X:52054240-52054262 AAGAGGCAAGCAGAGGATGGTGG - Exonic
1190612627 X:52199833-52199855 AAGAGGCAAGCAGAGGATGGTGG + Exonic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1192409505 X:70920464-70920486 GAAAGGAAGCAAGAGGAGTGAGG - Intergenic
1193205090 X:78738929-78738951 GAGAGGCATCAAGAGGAGGAAGG + Intergenic
1193333241 X:80258980-80259002 GAGAGGGAAAAAGGGGATGCAGG + Intergenic
1193740920 X:85216133-85216155 GAAAGGAAGCAAGAGCAGGGAGG + Intergenic
1193789624 X:85801916-85801938 GAGAGGAAGCAAGAGAGAGGAGG + Intergenic
1194365807 X:93012178-93012200 GAGAGGAAGAAAGAGGAAGTGGG - Intergenic
1194658992 X:96607865-96607887 AAAGGGAAACAAGATGATGGAGG - Intergenic
1195331844 X:103809189-103809211 GTGAGGAAACAATAAGATGGTGG + Intergenic
1195424533 X:104713439-104713461 GAGTGAAAACAAGAGTAAGGTGG - Intronic
1195490053 X:105457417-105457439 TAGAGGATACAAGAGGCTGAGGG - Intronic
1195840546 X:109171994-109172016 GACAGGAAACCTGTGGATGGTGG + Intergenic
1196812618 X:119640722-119640744 GATAGGCAACAAGATGATGAGGG - Exonic
1196816925 X:119672349-119672371 AGGTGGAAACTAGAGGATGGGGG + Intronic
1197260475 X:124312067-124312089 AAGAGGAAGAAAGGGGATGGTGG + Intronic
1197305361 X:124834768-124834790 AAGATGAAACAAGATGACGGGGG - Intronic
1197751076 X:129963871-129963893 GAGAGGAGAGGAGAGGAGGGGGG + Intergenic
1197831641 X:130649089-130649111 GAGAGGAAGCAAGAGGAGAGGGG - Intronic
1197836747 X:130702713-130702735 GAGAGGAAAGGAGACGGTGGAGG - Intronic
1198561779 X:137858233-137858255 GGGAGGAAACAGGAGGCTGGGGG + Intergenic
1198651742 X:138870714-138870736 GAAAGGAAAGAAGAGGCAGGAGG + Intronic
1198713969 X:139536302-139536324 GAGAGGAGAGGAGAGGAAGGAGG + Intronic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1199541850 X:148966445-148966467 GAGAGGAGAGAGGAGGAGGGAGG - Intronic
1199824582 X:151486114-151486136 GTGAGGAATCAAGAAGATGCAGG + Intergenic
1200166684 X:154040428-154040450 GAGAGAAAACAAGGGGGTGGGGG + Intronic
1200674029 Y:6128425-6128447 GAGAGGAAGAAAGAGGAAGTGGG - Intergenic
1201068359 Y:10121170-10121192 GGGAGGGAACAAGGGGATAGTGG + Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1201541059 Y:15105445-15105467 AAGAAGAAAGAAGAGGAGGGAGG - Intergenic
1201927418 Y:19303144-19303166 GAAAGAAAAGAAGAAGATGGAGG - Intergenic