ID: 1026395332

View in Genome Browser
Species Human (GRCh38)
Location 7:69947107-69947129
Sequence GGGTTTAAAGGGATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2047
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 2016}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026395325_1026395332 -2 Left 1026395325 7:69947086-69947108 CCGTACAAAACTGTAAATGCTGG 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 2016
1026395324_1026395332 28 Left 1026395324 7:69947056-69947078 CCAGCAGTGCTTGTTGTCGTTAC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 2016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026395332 Original CRISPR GGGTTTAAAGGGATTGAGGG AGG Intronic
Too many off-targets to display for this crispr