ID: 1026396580

View in Genome Browser
Species Human (GRCh38)
Location 7:69961209-69961231
Sequence CTGGTAAGGATCAGATCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026396577_1026396580 -3 Left 1026396577 7:69961189-69961211 CCACAGAGTCTTGAATGTAACTG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1026396580 7:69961209-69961231 CTGGTAAGGATCAGATCTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1026396576_1026396580 6 Left 1026396576 7:69961180-69961202 CCAGTGTCTCCACAGAGTCTTGA 0: 1
1: 0
2: 1
3: 14
4: 241
Right 1026396580 7:69961209-69961231 CTGGTAAGGATCAGATCTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026396580 Original CRISPR CTGGTAAGGATCAGATCTGT TGG Intronic
905972096 1:42149702-42149724 CTGGTAAGTCTGAAATCTGTAGG - Intergenic
906327291 1:44854983-44855005 CTGGTAAGGATGTGAGTTGTTGG + Intronic
908499089 1:64725014-64725036 CTAGTTACGATCAAATCTGTGGG - Intergenic
908920163 1:69180846-69180868 CTGGTAAGTATAAAATCTGCAGG + Intergenic
916414158 1:164576871-164576893 CTGGGAAGGATCTGTTCCGTGGG + Intronic
917825293 1:178813674-178813696 CTGGCAAGTATGAAATCTGTAGG + Intronic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
924369617 1:243334097-243334119 CTGGTGATGATGAGATGTGTGGG - Intronic
1068885384 10:62092176-62092198 TTGGGAAGGCTCAGATCTGTAGG - Exonic
1069987473 10:72294227-72294249 CTGGTAAGGGTCAAAGCTGTGGG - Intergenic
1070168094 10:73913047-73913069 CTGAAGAGCATCAGATCTGTGGG - Exonic
1073605256 10:104888380-104888402 CTGTTAAGGATCAGACCTTATGG + Intronic
1075471587 10:122694653-122694675 CTGGTTGGGAACAGAGCTGTAGG + Intergenic
1079324048 11:19476481-19476503 CTGCTTAGGATCAGATCAGTTGG - Intronic
1081238234 11:40672177-40672199 CTGGTAAGGGCCAGATTTCTAGG + Intronic
1081579785 11:44344380-44344402 CTGGAAAGGACAAGATCTCTGGG + Intergenic
1082932892 11:58627447-58627469 CTGATATGGATAAGATCTCTGGG + Intergenic
1085013588 11:73158044-73158066 CTGGAGGGGCTCAGATCTGTTGG + Intergenic
1085605191 11:77891310-77891332 CTGTTAAGGTCCAGGTCTGTCGG - Exonic
1087890853 11:103536641-103536663 CTGGCCAGGATCAAATCTGATGG - Intergenic
1090046925 11:123343836-123343858 CTGGAAATGAACAGATCTCTTGG + Intergenic
1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG + Intergenic
1092853819 12:12654466-12654488 CTGGCAAGGTTGAAATCTGTGGG - Intergenic
1093159178 12:15725171-15725193 CAGGTAAGTATCAGATTTGCTGG - Intronic
1097791483 12:63820281-63820303 CTTGTAAGCAACAGATCAGTGGG - Intergenic
1106986161 13:35353905-35353927 CTGGTAAGTCTGAAATCTGTAGG + Intronic
1108683253 13:52797535-52797557 CTGGTAAAGATGAGAAATGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1118434162 14:65754232-65754254 CAGGTAAGATTCAGAACTGTAGG - Intergenic
1118563095 14:67108185-67108207 CTGGGAAGATTCATATCTGTGGG + Intronic
1121120991 14:91375825-91375847 CTGGAAAGGGTCAGATCAGAAGG - Intronic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1123100564 14:105795927-105795949 CTGGGAAGGATCACTGCTGTGGG + Intergenic
1123432177 15:20227447-20227469 CTGGTTAGGATTAGACCAGTGGG + Intergenic
1129189595 15:73929637-73929659 CTGGTAAGGACCAGAGCAGGTGG - Intronic
1129459216 15:75691822-75691844 CTGGTATGGAGCATCTCTGTAGG + Intronic
1132460735 16:53330-53352 CTGGTCTGCAGCAGATCTGTGGG - Intronic
1132573010 16:652160-652182 CTGGCAAGGAGCAGAGCTGGCGG + Intronic
1136747083 16:32600227-32600249 CTGGTCAGGATCACAGCAGTTGG + Intergenic
1136852461 16:33623692-33623714 CTGGTTAGGATTAGACCAGTGGG - Intergenic
1139962517 16:70726071-70726093 CTTGTAAAGATCACAGCTGTCGG + Intronic
1141578749 16:84982866-84982888 CTGGTAAGGGGCAGAGCTGAAGG + Intronic
1203114061 16_KI270728v1_random:1472160-1472182 CTGGTTAGGATTAGACCAGTGGG - Intergenic
1144398310 17:14868133-14868155 CTGGTAGGGTTAAGATCTGAAGG - Intergenic
1148537500 17:48452667-48452689 TTGGTAAGGATGAGCTTTGTGGG + Intergenic
1150975284 17:70079133-70079155 CTGGCAAGTATGAAATCTGTAGG + Intronic
1156119839 18:33829376-33829398 CAGATAAGGCTCAGATCTCTCGG - Intergenic
1157549541 18:48571890-48571912 CTGGCAAGTCTGAGATCTGTAGG + Intronic
1158376896 18:56881448-56881470 CTGGCAAGGATCATACCTCTGGG + Intronic
1159102123 18:63969347-63969369 TTGGCATGGATCAGAACTGTAGG + Intronic
1166287631 19:41841754-41841776 CTGGTAAGGATCAGAAAGCTGGG + Intronic
1167729305 19:51241674-51241696 CTGGTAAGGATCTGTTCTTTGGG + Intronic
927071248 2:19531692-19531714 CTGGCAGGGATCTGATCTGACGG + Intergenic
928125765 2:28614680-28614702 CTGGTCCGGATCAGGTCTGTTGG + Intronic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
929032219 2:37659819-37659841 CTGGCACAGATCAGATATGTGGG + Intronic
930030823 2:47057039-47057061 CTGGGAAGGATCAGGGCCGTGGG + Intronic
932770292 2:74497287-74497309 CTGATAAGCATCAGCTCTGAAGG + Intergenic
933667664 2:84977339-84977361 ATGGTAAGGATCTTATCAGTGGG - Intronic
939597699 2:144147450-144147472 CTGCTAAAGATCAGATTTTTAGG - Intronic
940492825 2:154386542-154386564 ATGATAAGCATCAGTTCTGTGGG + Intronic
942367273 2:175240686-175240708 CTGGTAAAGATCTGTTGTGTGGG - Intergenic
946171224 2:217897116-217897138 GTTGTACAGATCAGATCTGTGGG + Intronic
1170163496 20:13339520-13339542 TTGGTAAGGATGAGATATGAAGG - Intergenic
1170973469 20:21138784-21138806 CAGGCAAGGCTCAGATCTATAGG - Intronic
1171568400 20:26219487-26219509 CTGGTAAGGATTAGATTTGAAGG + Intergenic
1180282519 22:10716159-10716181 CTGGTAAGGACTAGATTTGAAGG - Intergenic
1181426131 22:22840954-22840976 CTGACAAGGATTAAATCTGTTGG + Intronic
951349519 3:21588858-21588880 CTTGTAGGCTTCAGATCTGTTGG - Intronic
951904090 3:27686966-27686988 CTTGAAAGGATCAGAGATGTTGG + Intergenic
955775908 3:62432785-62432807 CTAGTAAGGATCAGGTCTGAAGG + Intronic
957110446 3:75948864-75948886 CTGGTAAGGATTAGATTTGAAGG - Intronic
960488541 3:118282142-118282164 CTGGTAAGGCTAAGATATTTAGG - Intergenic
961344605 3:126255895-126255917 CTGGTAAGTAGCAGAACAGTGGG - Intergenic
963219891 3:142797412-142797434 CTGGCAAGGATTAGTTCTGGAGG + Intronic
963637531 3:147817502-147817524 CTGGAAAGTATGAGATATGTGGG + Intergenic
964764954 3:160170694-160170716 CTGGAAAGAATGAGATGTGTTGG - Intergenic
967450719 3:189619685-189619707 CTGTTAAGAACCATATCTGTAGG + Intergenic
970109236 4:12618783-12618805 GTGCTAAGGATCAGACCTGTGGG + Intergenic
973551479 4:52039519-52039541 CAGTTAAGGAACAGATCTGTGGG - Intergenic
975747579 4:77490062-77490084 CAGGTAAGGATCAGATCATGTGG - Intergenic
976138359 4:81963005-81963027 ATGCTAAGGATCAGATATATGGG - Intronic
976264114 4:83173965-83173987 CTTGAAAGGAACAGATCTGAAGG - Intergenic
977109016 4:92927024-92927046 CAGGTAAGTATCAGATTTGGGGG - Intronic
978122515 4:105097636-105097658 CTGGTAAGTCTGAAATCTGTAGG - Intergenic
978226026 4:106336379-106336401 CTGGAAATGATCAAATGTGTAGG + Intronic
981835626 4:149050092-149050114 CTTCTAGGGATCAGCTCTGTGGG - Intergenic
987950827 5:24673571-24673593 AGGGTAAGGTACAGATCTGTGGG + Intergenic
1002955236 6:1856150-1856172 CTGGTGAGGATCAAACTTGTCGG + Intronic
1004911739 6:20292431-20292453 ATTGAAAAGATCAGATCTGTGGG - Intergenic
1012614521 6:101260461-101260483 CTGGGAAGGAATGGATCTGTTGG + Intergenic
1012787940 6:103656316-103656338 CTTTTCAGGATCAGATCTGAAGG - Intergenic
1016277339 6:142370206-142370228 CTGGTAAGCATCTGATGTCTGGG - Exonic
1016628701 6:146202278-146202300 CTGGTTAGTATGGGATCTGTCGG + Intronic
1019116447 6:169767374-169767396 CTCTAGAGGATCAGATCTGTGGG + Intronic
1022476807 7:30716370-30716392 CTTGTCAAGCTCAGATCTGTGGG + Intronic
1022626948 7:32046420-32046442 TTGGGAACAATCAGATCTGTTGG - Intronic
1025847411 7:65212781-65212803 CTGTTAAGGTCCAGGTCTGTCGG + Intergenic
1025897655 7:65718671-65718693 CTGTTAAGGTCCAGGTCTGTCGG + Intergenic
1026251749 7:68677368-68677390 CTGGTCTGTATCAGATCTGAAGG - Intergenic
1026396580 7:69961209-69961231 CTGGTAAGGATCAGATCTGTTGG + Intronic
1028393296 7:90338938-90338960 TTGGTAAAGATCAGGACTGTGGG - Intronic
1039626211 8:39057510-39057532 CTGCTAAGTGTCAGATCTGCAGG + Intronic
1041701982 8:60800523-60800545 CAGGTTAGTACCAGATCTGTGGG + Exonic
1043931666 8:86098649-86098671 CTGGGAAGGGTCCCATCTGTGGG + Intronic
1043945725 8:86250099-86250121 CTTGTAGGCAACAGATCTGTGGG + Intronic
1044804353 8:95989678-95989700 CTGGCAAGTTTCAGATCTGGAGG - Intergenic
1046348413 8:112969500-112969522 ATGGTAATGATCATATCAGTAGG - Intronic
1053153888 9:35760684-35760706 CTTGTAAAAATCAGATCTCTGGG - Intergenic
1056962715 9:91140873-91140895 CTGGCAAGTATAAAATCTGTAGG + Intergenic
1059928074 9:119232070-119232092 CTGGTAAGGACCAGTTTTGATGG - Intronic
1059979966 9:119760815-119760837 CTGGTAAGCCTGAAATCTGTAGG + Intergenic
1186615720 X:11185951-11185973 TAGGGAATGATCAGATCTGTTGG - Intronic
1187618341 X:21022367-21022389 CTTGTAGGGAACAGATCTTTGGG - Intergenic
1190068320 X:47258611-47258633 CAGGTAGTGATCAGATCAGTGGG - Intergenic
1190726891 X:53195691-53195713 CTGGTTAGGATGAGATTGGTGGG - Intronic
1193553497 X:82928001-82928023 CTGGTATGCATCAGTTCTGCTGG - Intergenic
1194285452 X:92005102-92005124 CTTGTAAGCAACAGATCAGTGGG + Intronic
1197381203 X:125742921-125742943 CTCATAAGCATCAGAGCTGTAGG - Intergenic
1197680002 X:129372545-129372567 CAGGTAAGCTTCAGATCTGCAGG + Intergenic
1198788054 X:140313134-140313156 CTGGTATGGAGCACATCTCTGGG + Intergenic
1199506115 X:148563205-148563227 TAGGCAAGGATCAGACCTGTGGG + Intronic
1200603022 Y:5229642-5229664 CTTGTAAGCAACAGATCAGTGGG + Intronic