ID: 1026400569

View in Genome Browser
Species Human (GRCh38)
Location 7:70008495-70008517
Sequence CTGTGTCAGTGGCCTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026400567_1026400569 1 Left 1026400567 7:70008471-70008493 CCAGCGTCTCTTCAAGCAATCTT 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026400569 Original CRISPR CTGTGTCAGTGGCCTGTGTA TGG Intronic
No off target data available for this crispr