ID: 1026411029

View in Genome Browser
Species Human (GRCh38)
Location 7:70123117-70123139
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026411029_1026411035 -8 Left 1026411029 7:70123117-70123139 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1026411035 7:70123132-70123154 TTCCAAAGCGCTGGGATTACAGG 0: 147
1: 13014
2: 309316
3: 270972
4: 207855
1026411029_1026411037 11 Left 1026411029 7:70123117-70123139 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1026411037 7:70123151-70123173 CAGGCGTGAGCCACCATGTTCGG 0: 16
1: 738
2: 11924
3: 54960
4: 134041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026411029 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr