ID: 1026416306

View in Genome Browser
Species Human (GRCh38)
Location 7:70184324-70184346
Sequence CTATGCTGGGTAAAGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026416299_1026416306 16 Left 1026416299 7:70184285-70184307 CCACAGAGAAGAGCAAATGCCAT 0: 1
1: 0
2: 2
3: 27
4: 264
Right 1026416306 7:70184324-70184346 CTATGCTGGGTAAAGTTTCCTGG No data
1026416302_1026416306 -3 Left 1026416302 7:70184304-70184326 CCATTGTTGGGAAGCAGAGCCTA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1026416306 7:70184324-70184346 CTATGCTGGGTAAAGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026416306 Original CRISPR CTATGCTGGGTAAAGTTTCC TGG Intronic
No off target data available for this crispr