ID: 1026418110

View in Genome Browser
Species Human (GRCh38)
Location 7:70204075-70204097
Sequence GAAAATAAAAACATAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8842
Summary {0: 1, 1: 0, 2: 38, 3: 589, 4: 8214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026418110_1026418113 10 Left 1026418110 7:70204075-70204097 CCCTCTTTTATGTTTTTATTTTC 0: 1
1: 0
2: 38
3: 589
4: 8214
Right 1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026418110 Original CRISPR GAAAATAAAAACATAAAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr