ID: 1026418111

View in Genome Browser
Species Human (GRCh38)
Location 7:70204076-70204098
Sequence GGAAAATAAAAACATAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3033
Summary {0: 1, 1: 1, 2: 15, 3: 310, 4: 2706}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026418111_1026418113 9 Left 1026418111 7:70204076-70204098 CCTCTTTTATGTTTTTATTTTCC 0: 1
1: 1
2: 15
3: 310
4: 2706
Right 1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026418111 Original CRISPR GGAAAATAAAAACATAAAAG AGG (reversed) Intronic
Too many off-targets to display for this crispr