ID: 1026418113

View in Genome Browser
Species Human (GRCh38)
Location 7:70204108-70204130
Sequence ATACCAGTGATGTAAGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026418111_1026418113 9 Left 1026418111 7:70204076-70204098 CCTCTTTTATGTTTTTATTTTCC 0: 1
1: 1
2: 15
3: 310
4: 2706
Right 1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG No data
1026418110_1026418113 10 Left 1026418110 7:70204075-70204097 CCCTCTTTTATGTTTTTATTTTC 0: 1
1: 0
2: 38
3: 589
4: 8214
Right 1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026418113 Original CRISPR ATACCAGTGATGTAAGATAG TGG Intronic
No off target data available for this crispr