ID: 1026419596

View in Genome Browser
Species Human (GRCh38)
Location 7:70220382-70220404
Sequence TTTAGTATCAGACGTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026419593_1026419596 7 Left 1026419593 7:70220352-70220374 CCTGCTGCATGCCAGCGTCACTC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 134
1026419594_1026419596 -4 Left 1026419594 7:70220363-70220385 CCAGCGTCACTCCTCATTCTTTA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 134
1026419590_1026419596 24 Left 1026419590 7:70220335-70220357 CCAACCTTTCCTCTGTACCTGCT 0: 1
1: 0
2: 3
3: 34
4: 445
Right 1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 134
1026419591_1026419596 20 Left 1026419591 7:70220339-70220361 CCTTTCCTCTGTACCTGCTGCAT 0: 1
1: 0
2: 0
3: 34
4: 347
Right 1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 134
1026419592_1026419596 15 Left 1026419592 7:70220344-70220366 CCTCTGTACCTGCTGCATGCCAG 0: 1
1: 0
2: 2
3: 31
4: 303
Right 1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026419596 Original CRISPR TTTAGTATCAGACGTGTGTT AGG Intronic
902133434 1:14283435-14283457 TTTTGTAAGAGACGTCTGTTTGG - Intergenic
902992500 1:20198693-20198715 TTTAGTATTAAAAGTGTGTTGGG - Intergenic
904917574 1:33981472-33981494 TTGAGTATCTGACTTGTGCTAGG + Intronic
907107672 1:51898954-51898976 TTTAATATTAGAAGTGTTTTGGG - Intergenic
909467450 1:75988834-75988856 TTTAATATTAGAAGTGTTTTGGG + Intergenic
921994633 1:221404842-221404864 TTTATTACCAAACATGTGTTTGG + Intergenic
1064888321 10:20138096-20138118 TTTAATATCAGAAGTGTTTTTGG + Intronic
1065634793 10:27720278-27720300 TTTAGTATTAGAGTTATGTTAGG - Intronic
1066157545 10:32694289-32694311 TTTACTATTAGAAGTGTTTTGGG + Intronic
1066195176 10:33092163-33092185 TTTAATATTAGAAGTGTTTTGGG + Intergenic
1067939684 10:50643775-50643797 TTTAATATTAGAAGTGTTTTGGG + Intergenic
1068680937 10:59819081-59819103 TTTAATATCAGAAGTATGTTGGG + Intronic
1070010869 10:72473140-72473162 TTTACTATTAGAAGTGTTTTGGG - Intronic
1073835595 10:107437515-107437537 TTTAATATTAGAAGTGTTTTGGG + Intergenic
1074122626 10:110504408-110504430 TGTAGTTTCAGGGGTGTGTTGGG + Intronic
1075065741 10:119287907-119287929 TTTGGGATCAGACAAGTGTTTGG - Intronic
1077790622 11:5435929-5435951 TTTAGGATCAGACTTGTGCCTGG + Intronic
1079171840 11:18104061-18104083 TTTAATATTAGAAGTGTTTTAGG + Intronic
1079425157 11:20333454-20333476 GTTAGTATCACACCTGAGTTTGG + Intergenic
1080045611 11:27804721-27804743 CTTTATATCAGACCTGTGTTAGG + Intergenic
1080165029 11:29225728-29225750 TTTAGAATAAAATGTGTGTTTGG + Intergenic
1081886500 11:46501765-46501787 TTTAATATAAGAAGTGTTTTGGG + Intronic
1081953423 11:47066882-47066904 TTTAATATTAGAGGTGTGTAGGG + Intronic
1087010786 11:93512018-93512040 TTTAGTATTAGAAGTGTTTGGGG + Intronic
1087432616 11:98072463-98072485 TTTAATATTAGAAGTGTTTTTGG + Intergenic
1087456300 11:98390863-98390885 TCTAGTAAGAGATGTGTGTTTGG - Intergenic
1087813059 11:102629576-102629598 TTAAGTATCAGTTGTTTGTTAGG + Intergenic
1090486955 11:127121673-127121695 TTTACTATTAGAAGTGTTTTGGG + Intergenic
1091418175 12:309336-309358 TTTAATATCAGAAGTGTTTGGGG + Intronic
1092164070 12:6332048-6332070 TTTTGTGTCAGACGTGTTGTAGG + Intronic
1092667379 12:10817583-10817605 TTTTGTATATGACGTGAGTTAGG - Intergenic
1092970833 12:13693113-13693135 TTTAATATTAGAAGTGTGTTAGG + Intronic
1099056363 12:77846146-77846168 TTTAGTATTGGATGTGTTTTTGG - Intronic
1099317162 12:81098361-81098383 TTTACTATTAGAAGTGTTTTGGG + Intronic
1101293788 12:103399749-103399771 TTTAGTATCTGACTATTGTTAGG + Intronic
1101596622 12:106172027-106172049 TTTGGTCTCAAAGGTGTGTTGGG - Intergenic
1103417910 12:120756836-120756858 TTTAATATCAGCAGTGGGTTGGG + Intergenic
1104090106 12:125509233-125509255 TGTGGTATCAGAGGTGTGGTGGG + Intronic
1109458209 13:62621855-62621877 TTTAGTTTCATACGTATGTTAGG - Intergenic
1111971897 13:94925437-94925459 TTTAGTATCAGTCCTGGGTTGGG + Intergenic
1112002055 13:95219784-95219806 TCTAGGATTAGAGGTGTGTTTGG + Intronic
1114880145 14:26774432-26774454 TTCAGAATCATACGTGGGTTAGG - Intergenic
1115347446 14:32358502-32358524 TTTGGTTTCTGACCTGTGTTGGG + Intronic
1121186396 14:91974649-91974671 TTTGGTCTCAAAGGTGTGTTGGG + Exonic
1125155820 15:36584044-36584066 TTTAATATTAGATGTGTTTTGGG - Intronic
1125389624 15:39178243-39178265 TTTATGATCAGATGTGTCTTAGG - Intergenic
1125805050 15:42486602-42486624 TTTAGTATTAGAAGTGTTTGGGG + Intronic
1125943718 15:43696453-43696475 TTTACCATCAGACATGTCTTGGG - Intronic
1127247588 15:57194697-57194719 TTCAGTCTCATACTTGTGTTAGG + Intronic
1129451954 15:75656169-75656191 TTTAGAATCAGCAGTGTGATGGG + Intronic
1131807341 15:96136381-96136403 TTTAATATTAGAAGTGTTTTAGG + Intergenic
1132949400 16:2552448-2552470 TTTCCTATCAGAGGTGTGGTTGG + Intronic
1132964950 16:2647724-2647746 TTTCCTATCAGAGGTGTGGTTGG - Intergenic
1133599334 16:7323836-7323858 TTATGTATCAGACCTGTGCTAGG - Intronic
1134263817 16:12675590-12675612 TTTAGTATCAGAATTGTACTGGG - Intronic
1137263598 16:46850879-46850901 TGAAGTATCAGAGGTGTGTTTGG - Intergenic
1137366170 16:47861695-47861717 TTTAATATCAGAAGTGTTTTGGG + Intergenic
1137367872 16:47876371-47876393 TTTAATATCAGAAGTGTTTTGGG + Intergenic
1137599309 16:49745287-49745309 TTTAGTAACATAAGTGTTTTGGG - Intronic
1138218922 16:55233232-55233254 TTTAATATTAGACGTGTTTTGGG + Intergenic
1138698083 16:58834319-58834341 TCTAGTATCCGAGGTGTGTGAGG - Intergenic
1139089426 16:63627003-63627025 TTTAGTATGAAACGTATTTTTGG - Intergenic
1141291267 16:82720048-82720070 TTTAATATTAGAAGTGTTTTGGG - Intronic
1149730913 17:58945441-58945463 TTTAGTGTCAGAAGTGTGTGAGG - Intronic
1155466738 18:26144082-26144104 TTTAATATTAGAGGTGTTTTAGG + Intronic
1155493926 18:26424659-26424681 TTTAGGATCAGACGTGAGGATGG + Intergenic
1157225463 18:45859269-45859291 TTTAGTAACACACATGAGTTTGG + Intronic
1160129949 18:76216505-76216527 TCTTTTATCAGACATGTGTTTGG + Intergenic
925838071 2:7965185-7965207 GTAAGTATCAGACGTGTGTGCGG - Intergenic
930037108 2:47093205-47093227 TTGATTATCAGATGTGTGCTTGG - Intronic
931065531 2:58581834-58581856 TTTAATATTAGAAGTGTTTTGGG + Intergenic
931956297 2:67429349-67429371 TTTAATATTAGAAGTGTTTTGGG + Intergenic
938762820 2:134440944-134440966 TTTAATATTAGAAGTGTTTTGGG + Intronic
940661313 2:156548487-156548509 TTTAGAATAAGACGTTTGTGGGG + Intronic
941363223 2:164579290-164579312 TTTAATATCAGAAGTGTTTTGGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169590996 20:7142189-7142211 TTTAATATTAGAAGTGTTTTGGG - Intergenic
1170738540 20:19032160-19032182 TTTAATATTAGAAGTGTTTTGGG - Intergenic
1174034113 20:47656339-47656361 TTTAATATCTGAGGTGAGTTGGG + Intronic
1176519002 21:7811080-7811102 TTTAGTATTAGAAGTGTTTGAGG + Intergenic
1178653030 21:34441093-34441115 TTTAGTATTAGAAGTGTTTGAGG + Intergenic
1180751810 22:18129887-18129909 TTTGGTTTGGGACGTGTGTTGGG + Intronic
951515726 3:23557038-23557060 TTTAGTATTAGGAGTGTTTTAGG - Intronic
953649590 3:44789885-44789907 TTTAATATTAGAAGTGTGTTGGG - Intronic
954916617 3:54153466-54153488 TTGAGTATCTGCCATGTGTTAGG + Intronic
955310610 3:57882956-57882978 TTATGTGTCAGAAGTGTGTTGGG + Intronic
955373712 3:58376033-58376055 TTTATTATTAGACATGTTTTAGG + Intronic
956350358 3:68328400-68328422 TTTAGTTTCAGATTTGTGTTTGG + Intronic
958481094 3:94646907-94646929 TTTAGTATCTGAGGAATGTTGGG + Intergenic
959559198 3:107759976-107759998 TTTATTATCTGCTGTGTGTTAGG + Intronic
960044404 3:113182695-113182717 TTTAGTATTAGAAGTGTTTTGGG - Intergenic
961401906 3:126653117-126653139 TTTAATATTAGACATGTTTTGGG + Intronic
966008781 3:175050502-175050524 TTTAATATTAGAAGTGTTTTGGG + Intronic
967695238 3:192523550-192523572 TTTATTATCAGACTTGGGTAGGG - Intronic
970509544 4:16767554-16767576 TTTAGTATCTGAACTGTGTGTGG + Intronic
971558416 4:28042491-28042513 TTTAGTATCAGAAGTGTTTAGGG + Intergenic
972334183 4:38092363-38092385 TTTAATATTAGAAGTGTCTTGGG - Intronic
976365199 4:84225447-84225469 TTTAGGACCAGAAGTGTTTTGGG - Intergenic
976736574 4:88316243-88316265 TTTAATATTAGAAGTGTTTTAGG + Intergenic
979562828 4:122119705-122119727 GTTAGTAAAACACGTGTGTTTGG + Intergenic
985222869 4:187726358-187726380 TTTGGTATCACAGATGTGTTAGG - Intergenic
986023094 5:3822995-3823017 TTTAATATTAGACGTGTTTGGGG + Intergenic
988351936 5:30119606-30119628 TTTAGTATTAGAAGTGTTTTTGG + Intergenic
988948451 5:36232074-36232096 TTTAATATCAGAGCTGTGTGGGG - Intronic
989624731 5:43418372-43418394 TTTAATATGAGACTTCTGTTTGG - Intergenic
991716858 5:69459222-69459244 TTTTGTATATGGCGTGTGTTAGG + Intergenic
992850986 5:80807353-80807375 TTTAATATTAGAAGTGTGTTGGG - Intronic
993729908 5:91410192-91410214 TTTAATATTAGAAGTGTCTTGGG - Intergenic
994961781 5:106614462-106614484 TTTAGTTACAAACCTGTGTTGGG - Intergenic
995327199 5:110904440-110904462 TTTGGTTTCAGACCTCTGTTAGG - Intergenic
995475679 5:112545749-112545771 TTTAGTTTTATGCGTGTGTTGGG - Intergenic
995549058 5:113262678-113262700 TTTAGTCCCAAACCTGTGTTTGG - Intronic
995782013 5:115787027-115787049 TTTAGTATTAGAAGTGTTTTGGG + Intergenic
1000790716 5:165603380-165603402 TTTAGTATTAGAAGTGTTTTGGG + Intergenic
1009722077 6:67485339-67485361 TTTACTATAATACATGTGTTAGG + Intergenic
1010936420 6:81868083-81868105 CTTAGTATGAGATCTGTGTTTGG - Intergenic
1012248327 6:96952283-96952305 TTTAATATTAGAAGTGTTTTGGG + Intronic
1014032532 6:116722179-116722201 TGTGTTAGCAGACGTGTGTTGGG + Exonic
1014572302 6:123024760-123024782 TTTAACATCAGAAGTATGTTGGG + Intronic
1015104167 6:129517036-129517058 TGTAGTATCAAATGTGTGCTTGG - Intergenic
1015241079 6:131024301-131024323 TTTGATATCACTCGTGTGTTGGG + Intronic
1017414605 6:154206453-154206475 TTTAGTTTCAAATGTGTGCTAGG + Intronic
1020845816 7:13281747-13281769 TTTAGAATCAGAAGTATGTTAGG - Intergenic
1020991316 7:15199822-15199844 TCAAGTATCAGAAGTGGGTTTGG - Intergenic
1021136631 7:16972360-16972382 TTTAATATTAGAAGTGTTTTGGG + Intergenic
1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG + Intronic
1026824810 7:73574850-73574872 TTTGGAATCAGACCTGGGTTTGG + Intronic
1027468719 7:78547182-78547204 TTTAGTATTAGAAGTGTTTGGGG - Intronic
1028258147 7:88626595-88626617 TTTAATATTAGACGTGTTTGGGG - Intergenic
1028612973 7:92732815-92732837 TTCAGTATAAGACGTGGGTGAGG - Intronic
1030161505 7:106513511-106513533 TTTAGTACTAGAGCTGTGTTGGG - Intergenic
1031957062 7:127953361-127953383 TTTAGAATGAGAAGTGTGTGGGG - Intronic
1036214755 8:6870037-6870059 TTGAGAATCAGTCATGTGTTGGG + Intergenic
1036678895 8:10856070-10856092 TTTAATAACACACGTGTGTGTGG - Intergenic
1039260363 8:35764852-35764874 TTTAGAAACAGATGTGAGTTGGG - Intronic
1041207121 8:55510613-55510635 TTTAGGATCAGATGTGGGGTGGG - Intronic
1041797641 8:61762334-61762356 TTTAGTATTAGAAGTGTTTAGGG - Intergenic
1042489402 8:69380971-69380993 TTGAGTTGCAGACGTTTGTTGGG - Intergenic
1043910257 8:85855725-85855747 TTTAATATTAGAAGTGTTTTGGG + Intergenic
1044022356 8:87120894-87120916 TTTAGCATCAGATTTGTGCTGGG + Intronic
1044323881 8:90838346-90838368 TTTAGTATTAGAAATGTTTTGGG - Intronic
1046689035 8:117262075-117262097 TTGAGTATCAGCTGTGGGTTAGG - Intergenic
1047839632 8:128736712-128736734 TTTAATATCAAAAGTGTTTTTGG + Intergenic
1049130535 8:140836129-140836151 TTTAATATTAGAAGTGTTTTGGG + Intronic
1049169358 8:141149441-141149463 TTTAATATCAGAAGTGCTTTGGG - Intronic
1049387237 8:142349171-142349193 TTTTCTTTCAGATGTGTGTTCGG + Intronic
1050383083 9:5051870-5051892 TTTACTTTCAGATGTCTGTTAGG + Intronic
1052401274 9:28003427-28003449 TTTACTATTAGAGGTGTTTTGGG + Intronic
1057108172 9:92441040-92441062 TTTAATATTAGAAGTGTTTTGGG - Intronic
1060081357 9:120649671-120649693 TTTATTATTAGAAGTGTTTTTGG + Intronic
1192361398 X:70442924-70442946 TTCAATATCAGAAGTGTTTTGGG + Intergenic
1193700939 X:84760405-84760427 ATTAGTATCAGACCTATCTTTGG - Intergenic
1195097426 X:101516737-101516759 TTTTCTATCAGACGAGGGTTTGG - Intronic
1195419814 X:104662096-104662118 CTTAGTAACAGATGTGAGTTAGG + Intronic
1195477795 X:105306472-105306494 TTTAGTATCACACATTTCTTAGG + Intronic
1195770555 X:108346733-108346755 TTTAATATTAGAAGTGTTTTGGG - Intronic
1197007262 X:121516205-121516227 TTTAATATAAGAAGTGTTTTTGG + Intergenic
1197827301 X:130603509-130603531 TTTACTATTAGATGTGTTTTGGG + Intergenic