ID: 1026420305

View in Genome Browser
Species Human (GRCh38)
Location 7:70229785-70229807
Sequence ATTTCAACACAGATTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026420305_1026420307 18 Left 1026420305 7:70229785-70229807 CCTGGATCAATCTGTGTTGAAAT 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1026420307 7:70229826-70229848 GCCGTTCAAATCTCCTGGTGAGG No data
1026420305_1026420306 13 Left 1026420305 7:70229785-70229807 CCTGGATCAATCTGTGTTGAAAT 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1026420306 7:70229821-70229843 CTTCTGCCGTTCAAATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026420305 Original CRISPR ATTTCAACACAGATTGATCC AGG (reversed) Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
908872678 1:68632038-68632060 CTTTCTACAGTGATTGATCCAGG + Intergenic
910483876 1:87688677-87688699 ATTTAAGCAAAGATTGAACCTGG - Intergenic
911064606 1:93777019-93777041 ATTTGAACACAGATAGACACAGG + Intronic
912334745 1:108851724-108851746 TTTTCAACACAGTTTGACTCAGG + Exonic
920837909 1:209528852-209528874 TTTTCCACACAGAATGATTCTGG - Intergenic
922887861 1:229033886-229033908 ATTTGAACACAAATTGCTCAGGG - Intergenic
923057342 1:230436947-230436969 ATTTCAACACTGATTTATGTTGG - Intergenic
923187034 1:231584444-231584466 ATTTAAAAACAGATAGATACAGG - Intronic
924724209 1:246653169-246653191 ATGACAACCCAGATTGCTCCTGG + Intronic
1063257114 10:4340541-4340563 TTTTCAACTTAGATTGCTCCAGG - Intergenic
1064504534 10:16014472-16014494 ATTTCCACTCAGATGGGTCCAGG + Intergenic
1065503364 10:26403533-26403555 AGTGCAACAGAGATTGTTCCGGG - Intergenic
1065580751 10:27169260-27169282 AGTTCAAAACAGAATCATCCAGG + Intronic
1066299564 10:34084795-34084817 ATGTCACAACAGATTGAGCCAGG - Intergenic
1069096096 10:64261672-64261694 ATTTCTACTCAGATTGAGTCTGG + Intergenic
1069457772 10:68567363-68567385 ATTTTTAAACAGATTGAACCCGG + Intronic
1069732796 10:70630124-70630146 ATTTCAAGACAAATGAATCCAGG + Intergenic
1071212218 10:83356629-83356651 AGTTCAACACAGATTGGAGCAGG + Intergenic
1074551843 10:114450808-114450830 AATTCTACACAGATTGTGCCTGG - Intronic
1074961873 10:118454167-118454189 AATTAAACACAGATTGAGGCAGG - Intergenic
1076323661 10:129603537-129603559 ATTTCAAGAGTGATTAATCCTGG + Intronic
1084293688 11:68195447-68195469 GGTACAACACAGATAGATCCAGG + Intronic
1086807866 11:91267856-91267878 AGTTGAACACGGATTGATACTGG - Intergenic
1093444402 12:19239725-19239747 AGTTCAGCACAGATTGAAGCTGG - Intronic
1094425979 12:30317559-30317581 AGTTAAACACAAATTGAGCCAGG + Intergenic
1094426185 12:30319732-30319754 AGTTAAACACAAATTGAGCCAGG + Intergenic
1095089121 12:38087706-38087728 ATTTTAAGCCAGATTGGTCCTGG - Intergenic
1097818869 12:64106622-64106644 ATTTCCACCCAGTTTGGTCCTGG - Intronic
1098765650 12:74485441-74485463 CTTTAAACATAGATTGTTCCGGG - Intergenic
1103313716 12:120034011-120034033 ATTTCAACACAGCCAGATACAGG + Intronic
1105840566 13:24250385-24250407 AATTCAACAAATATTTATCCGGG + Intronic
1106630365 13:31465876-31465898 ATCTCATCACGAATTGATCCTGG + Intergenic
1110784963 13:79512944-79512966 ATGACAACACAGAGTAATCCTGG - Intronic
1113819260 13:113200789-113200811 ATTTCAAAATAGGTTGTTCCTGG + Intronic
1118513152 14:66498579-66498601 ATTTCCACCCAGATTGGTCGGGG - Intergenic
1118897648 14:69959542-69959564 ATATCAAGAAAGATTGTTCCTGG - Intronic
1120743405 14:88132238-88132260 CTTTCAAGACAACTTGATCCTGG + Intergenic
1124709005 15:31989716-31989738 ATTTGAACTTAGATTGATTCTGG - Intergenic
1125487290 15:40120928-40120950 ATTAAAACACAGATTGAGCTGGG - Intergenic
1126687723 15:51262988-51263010 ATTTCAAGAAAGATTAAACCAGG + Intronic
1134778987 16:16878253-16878275 CTTTAAACAAAAATTGATCCAGG - Intergenic
1135051748 16:19198876-19198898 ATTTCAACTCAGTTTGATTGAGG + Intronic
1136126952 16:28190585-28190607 ACCTGACCACAGATTGATCCTGG + Intronic
1136998586 16:35208346-35208368 ATGACAACACAGATTGAGACAGG + Intergenic
1137947034 16:52743427-52743449 CTTGCAACACAGCTTGACCCAGG + Intergenic
1138015573 16:53425408-53425430 ATTTAAACACAGTTTGGACCGGG + Intergenic
1139163207 16:64536109-64536131 ATTTCAAGGCAGAGTGTTCCTGG + Intergenic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1150188990 17:63217676-63217698 ATTTCTACACAGACTCCTCCAGG + Intronic
1151022740 17:70637449-70637471 CTTTCAATAAAGATTGATACAGG + Intergenic
1151446423 17:74168260-74168282 ATTTCAAAACAAATTTTTCCTGG - Intergenic
1151754455 17:76065090-76065112 AGTTTAAGACAGATTGATCAAGG - Intronic
1155614905 18:27710821-27710843 ATGTCAAGGCAGATTGATGCTGG - Intergenic
1156515122 18:37672778-37672800 TTTTGAAAACAGATAGATCCAGG - Intergenic
1157992757 18:52517159-52517181 TTTACAACACAGATTGCTTCTGG - Intronic
1159920869 18:74226413-74226435 ATTCCAACACAGATACTTCCTGG - Intergenic
1163262600 19:16200166-16200188 ATTACCACACAGTTGGATCCAGG + Intronic
925877088 2:8320811-8320833 AGTTCATCACAGACTTATCCTGG + Intergenic
927586188 2:24307837-24307859 ATTTCGACAGAGATTGAACGTGG - Intronic
928965126 2:36968125-36968147 TTATCATCAAAGATTGATCCAGG + Intergenic
930883615 2:56299409-56299431 ATTGCAGCACAGATGCATCCAGG - Intronic
933306714 2:80609525-80609547 ATTGCAAGACAGATTGCTCTTGG - Intronic
933537084 2:83589096-83589118 ACTCCAACACAGAGTGAACCTGG + Intergenic
933896580 2:86815834-86815856 AATTCAACACAGAAAGAGCCAGG + Intronic
935524071 2:104144115-104144137 ATTTCAGCTCAGCTTGATCTTGG + Intergenic
936018321 2:108975966-108975988 AATTCAATACAGAGTGTTCCCGG + Intronic
939260970 2:139808417-139808439 ATTTCATTACAAATTGATTCTGG - Intergenic
941189468 2:162360793-162360815 ATTTCACTACAGATTGAACTAGG - Exonic
945412423 2:209527172-209527194 ATTTCTACACAGGGTGATACAGG - Intronic
946767249 2:223052099-223052121 TTTACAACAGAGATTGATCGTGG - Exonic
948687941 2:239682456-239682478 AATTCAAAACACATTCATCCAGG - Intergenic
1170082142 20:12488301-12488323 ATTGCAACACAGATGGTTTCTGG + Intergenic
1170303640 20:14913912-14913934 ATTTGAATACAGCTTGGTCCTGG + Intronic
1171250724 20:23645066-23645088 ATTTCAACACAGCGTGGTGCAGG + Intergenic
1174058542 20:47816313-47816335 ATTTCTATACATATTGAGCCAGG - Intergenic
1174405361 20:50299339-50299361 ATCTCAGCAAAGATTGATGCAGG - Intergenic
1176312751 21:5162188-5162210 ATTTCACTACAGAGTGAACCAGG + Intergenic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312770 21:5162305-5162327 ATTTCAATACAGCTAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312800 21:5162500-5162522 ATTTCACTACAGAGTGAACCAGG + Intergenic
1178614081 21:34115151-34115173 AGTTCAGCACACATTAATCCTGG - Intronic
1179577143 21:42315061-42315083 ATTTCAACACAGACTGGGCAGGG + Intronic
1179844248 21:44099530-44099552 ATTTCACTACAGAGTGAACCAGG - Intronic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844278 21:44099725-44099747 ATTTCAATACAGCTAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1179844297 21:44099842-44099864 ATTTCACTACAGAGTGAACCAGG - Intronic
1182412542 22:30199379-30199401 ATTTCTACCCAGAGAGATCCTGG - Intergenic
1183076297 22:35429452-35429474 ATTTCAAGATTGATTGTTCCGGG + Intergenic
951024610 3:17816233-17816255 GTTTGGACACAGTTTGATCCTGG + Intronic
957131770 3:76232041-76232063 GTTTCATCATACATTGATCCTGG + Intronic
958110815 3:89141924-89141946 ATTTTTACACAGATTCCTCCAGG + Intronic
960607757 3:119525564-119525586 ATTTCAAAACACCTTGATCAAGG + Exonic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
961541072 3:127599659-127599681 CTTTGAGCACAGCTTGATCCAGG + Intronic
967863503 3:194171348-194171370 ATTTCAATGCAGTTTGACCCAGG + Intergenic
969332658 4:6488381-6488403 ATTTATAAACAGTTTGATCCTGG + Intronic
973100348 4:46260308-46260330 ATTTTGACATAGATTTATCCTGG + Intronic
975477786 4:74843263-74843285 ATTTCAGCTGAGATTGATCTGGG - Intergenic
978436555 4:108691330-108691352 ATTAAAACCCAGATTGACCCTGG - Intergenic
980334530 4:131454125-131454147 ATTTCAAAAGAGATTGATAAAGG - Intergenic
990431070 5:55736425-55736447 ATAGCAACACAGTTTGATACTGG - Intronic
992190475 5:74286632-74286654 AATTCAGCAAAGATTGATCAAGG + Intergenic
993009774 5:82467422-82467444 AATACAACACAGATGGATGCTGG - Intergenic
994728245 5:103461850-103461872 ATTTCAATATAGATTTTTCCTGG - Intergenic
996422392 5:123277359-123277381 ACTTAAACACAGAGTGATTCTGG - Intergenic
998876243 5:146602722-146602744 ATTTCAATTCTGATTGATCAGGG - Intronic
1002866243 6:1124815-1124837 AATTCAACACAGATTAATTGGGG + Intergenic
1003297700 6:4847674-4847696 ATTACCACACTGATTGATCCTGG - Intronic
1005472458 6:26174842-26174864 ATTTCAAAACAAATTAACCCTGG - Intergenic
1009043442 6:58209838-58209860 ATTTCAAACCAGATACATCCAGG - Intergenic
1009219276 6:60964100-60964122 ATTTCAAACCAGATATATCCAGG - Intergenic
1009316981 6:62231981-62232003 ATTTCAAAACATATTAAACCAGG - Intronic
1011458359 6:87576799-87576821 AATTCAACACAGATGTATGCTGG + Intronic
1014082030 6:117298837-117298859 ATTTCAACACTTACTGATCTGGG - Intronic
1016144626 6:140654101-140654123 ATCTAAACAAAGATTGTTCCTGG + Intergenic
1016979274 6:149839266-149839288 ATTTGAAGATATATTGATCCAGG + Intronic
1017027143 6:150191197-150191219 ATTTCAACAACAGTTGATCCTGG - Intronic
1018164735 6:161082629-161082651 ATTCCAACACCGACTGACCCTGG - Intronic
1018477355 6:164156943-164156965 ATATCATCACACATTGATCTGGG - Intergenic
1019013266 6:168860492-168860514 ATTTAAACACAGTTTGAACCGGG - Intergenic
1021275470 7:18644957-18644979 ATTTCAAGTCAGAATTATCCTGG + Intronic
1023068744 7:36406097-36406119 AATTCAGCATAGAGTGATCCTGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026109704 7:67449308-67449330 ATATCAACACAGAAAGATCAGGG - Intergenic
1026420305 7:70229785-70229807 ATTTCAACACAGATTGATCCAGG - Intronic
1029106916 7:98184986-98185008 ATTTCCATACAGCATGATCCTGG + Intronic
1029308631 7:99640727-99640749 TTATCAAAACATATTGATCCTGG - Intergenic
1030484792 7:110151844-110151866 ATCCCAACACACATTGCTCCAGG + Intergenic
1031068022 7:117128683-117128705 ATTTCAACACAGTGTGATAATGG - Intronic
1034046654 7:147936504-147936526 AGTTCAACACAGAATGATAAAGG + Intronic
1036613392 8:10369328-10369350 ATTTGAACATAGCATGATCCTGG + Intronic
1039422733 8:37457741-37457763 TATTCAACACAGAAAGATCCAGG - Intergenic
1041445098 8:57942504-57942526 ATGACAACATAGATTGATTCTGG - Intergenic
1044151980 8:88790908-88790930 ATTTAAAAACAGATTTATCTGGG - Intergenic
1044742101 8:95337960-95337982 ATTTCACCACAGAGTAGTCCTGG - Intergenic
1047594306 8:126361952-126361974 ATTTCTCCAGAGATTCATCCAGG - Intergenic
1051279869 9:15431494-15431516 AATTGAACTCAGATTGATACAGG + Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1057797061 9:98165379-98165401 ATTTCAAAGCAGAATAATCCAGG + Intronic
1058023920 9:100119245-100119267 ATTTCTACAAAGATTGCTCTGGG + Intronic
1058931029 9:109719112-109719134 AATTCATCACTGATTGAGCCTGG + Intronic
1187299050 X:18030369-18030391 ATTTCAGCAAAGGTTGATCTTGG + Intergenic
1187814527 X:23216604-23216626 AATTCAACACAGATTTATGAAGG - Intergenic
1189565923 X:42241035-42241057 AATTCTACAGAGATTCATCCAGG - Intergenic
1190742702 X:53300458-53300480 ATTTCAGAACAGTTTGATCAGGG - Intronic
1192222544 X:69207273-69207295 TTTCCAACACAGATTGCTCATGG + Intergenic
1193763899 X:85502198-85502220 ATTTTTATACAGATTGATGCAGG + Intergenic
1195635537 X:107110776-107110798 CTTTCCACACTGAATGATCCTGG - Intronic
1196150443 X:112367753-112367775 ATTAAAACACAGAGTGATCAAGG + Intergenic
1199362466 X:146938424-146938446 ATTTCTTCACAGTTTGATCTTGG + Intergenic
1200897032 Y:8386650-8386672 TTTGCAACACTGATTGATGCTGG - Intergenic
1201340203 Y:12925395-12925417 AATTCAACACAGTCTGAACCCGG - Intergenic