ID: 1026421468

View in Genome Browser
Species Human (GRCh38)
Location 7:70241588-70241610
Sequence TTTTCTTACAGGGGTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026421468_1026421477 21 Left 1026421468 7:70241588-70241610 CCTGTGGGACCCCTGTAAGAAAA 0: 1
1: 0
2: 1
3: 15
4: 111
Right 1026421477 7:70241632-70241654 AATTCCTTAATAAGTCCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026421468 Original CRISPR TTTTCTTACAGGGGTCCCAC AGG (reversed) Intronic
900582144 1:3414588-3414610 TTCTCCTTCAGGGCTCCCACGGG - Exonic
902833740 1:19034017-19034039 TTGTCTTACTGGGTTCTCACTGG - Intergenic
903226390 1:21896299-21896321 TTTGCTTACAGGTGACCCATGGG - Exonic
905237523 1:36560400-36560422 CTTTCTAGTAGGGGTCCCACGGG + Intergenic
907472245 1:54681370-54681392 TTTGCTTCCAGGGTCCCCACAGG + Intronic
915557820 1:156670035-156670057 TTTTCTTCCTGGGGTCCCTGGGG - Exonic
917136372 1:171792006-171792028 TTTTCTTACAGAGATCCCACTGG + Exonic
917567606 1:176229406-176229428 TTCTCCTACAGGGGTTCCAGAGG - Intergenic
918738476 1:188097040-188097062 TTTTATTATAGAGGTGCCACAGG + Intergenic
921064515 1:211613185-211613207 TCTTCTTACAGTGGTCCAGCGGG - Intergenic
923458612 1:234187784-234187806 TTGTCTCACAGGGGTCCCTGGGG + Intronic
924839913 1:247697904-247697926 TTTTCTAACAGGGTACACACAGG - Intergenic
1064308798 10:14192829-14192851 TTTTCTTCCAGGGGTCACAAAGG + Intronic
1067509461 10:46883195-46883217 TTTACTGAGAGGGGCCCCACAGG + Intergenic
1067652793 10:48168660-48168682 TTTACTGAGAGGGGCCCCACAGG - Exonic
1069223491 10:65911995-65912017 TCCTCTTCCAGGGGTCACACAGG - Intergenic
1071570900 10:86696279-86696301 CTTTCTTACAAGGGGCCCATTGG - Intronic
1071932215 10:90485026-90485048 TTGTCTTACAGGGGTCCTTTGGG - Intergenic
1072997517 10:100258710-100258732 TTTGCTTAAAGAAGTCCCACAGG + Intronic
1074581304 10:114721886-114721908 TTTGCTTATAGGAATCCCACTGG - Intergenic
1074581390 10:114722679-114722701 TTTGCTTATAGGAATCCCACTGG + Intergenic
1081129006 11:39353617-39353639 TTTTCTGATAGATGTCCCACTGG - Intergenic
1082935107 11:58647756-58647778 TTATCTTACAGGGGTCCTTGGGG - Intronic
1085632234 11:78128013-78128035 TTTTCTTACAGGCGGCCCTCAGG + Intronic
1085946326 11:81277635-81277657 TTTTCTCAGAGGAGTCCCAGGGG - Intergenic
1090634231 11:128679922-128679944 TTTTCTCAAAGGTGTCCCAAAGG + Intergenic
1091673074 12:2466974-2466996 TTGTCTTATAGGGGTCTTACAGG + Intronic
1092720212 12:11433587-11433609 TTCTCTTTCAGGGATCCCCCAGG - Intronic
1098964401 12:76771227-76771249 TTTTCTTAAAGTGGAGCCACAGG + Intronic
1103581351 12:121918006-121918028 GTTTCCTGCAGGGGTCCCAGTGG + Exonic
1104613996 12:130253585-130253607 TTATTTTAGAGGGGTCCCACTGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107702096 13:43058743-43058765 TTATCTCACAGGGGTCCTTCGGG - Intronic
1108578054 13:51805994-51806016 TTTTATCACATGGGTCACACAGG - Intergenic
1109610958 13:64763952-64763974 TTTTTTTTAAGGGGTCCAACTGG + Intergenic
1110790776 13:79584460-79584482 TTTACTTCCAGGAGCCCCACTGG + Intergenic
1111364404 13:87223421-87223443 TTTTTTTACAGAGGACCTACAGG + Intergenic
1113076394 13:106471858-106471880 TATTCTTAGAAGGGGCCCACGGG + Intergenic
1113867959 13:113540819-113540841 TTTTCTTACAGGGATTTTACAGG + Intronic
1116045243 14:39734716-39734738 TTTTCTCACAGGGGTCCTTGGGG - Intergenic
1116392086 14:44404943-44404965 TTTTCTTTAAGAGGGCCCACAGG - Intergenic
1117271229 14:54146039-54146061 TTTTCTGACAGGGGTCCTTTGGG + Intergenic
1120601930 14:86521512-86521534 TTTTCTTACAGGGCAGACACAGG + Intergenic
1121459220 14:94061114-94061136 TTTTCTTACATGGCTGACACAGG + Intronic
1129392494 15:75227521-75227543 TTTTCTTACGTGTCTCCCACCGG - Intergenic
1130088062 15:80795250-80795272 TTTTTTTAAAGGGATCCCTCTGG + Intronic
1131409507 15:92195098-92195120 TTTTGTTACAGCAGTCCCAATGG + Intergenic
1131733450 15:95306398-95306420 TTTTGTTACAAGGTTGCCACAGG - Intergenic
1133621789 16:7533275-7533297 TTTTCTTTCTGGAGTTCCACAGG - Intronic
1138004794 16:53322727-53322749 TATTCTTACAGGTGTCCAAATGG + Intronic
1140785048 16:78332778-78332800 TTTACTAACATGGGTTCCACAGG + Intronic
1143663910 17:8345293-8345315 TTGTCATACAAGAGTCCCACAGG - Intronic
1147356777 17:39904704-39904726 TTGTTTTAAAGAGGTCCCACTGG + Exonic
1150972158 17:70041023-70041045 TATTTTTACAAGGGTCCCAGAGG + Intergenic
1151838267 17:76598590-76598612 TTTTCTTCCTGGGCTCCAACAGG + Intergenic
1155122425 18:22835843-22835865 TATTCTTGCTGGTGTCCCACCGG - Intronic
1156046305 18:32881353-32881375 TTTTCTTCCATGGGCCCCACTGG + Intergenic
1157446145 18:47748262-47748284 TTTTCTCACATGGGTTCCCCAGG + Intergenic
1161651733 19:5489982-5490004 TGTCCTGACAGGGGTCCCTCTGG - Intergenic
925759921 2:7174691-7174713 TTTTCTTTCAGGGCTCTCAAAGG - Intergenic
928356570 2:30621785-30621807 TTTTCTCACAGGGGTCCTTGGGG + Intronic
928411554 2:31058179-31058201 GTTTCCTACAGGTATCCCACTGG + Intronic
929489726 2:42385526-42385548 TTTTGTTACAGGGGTCTGATGGG - Intronic
932108341 2:68969780-68969802 TTTTCCTTCAGAGGTCCCACTGG - Intergenic
934111501 2:88747566-88747588 TTATCTCACAGGGGTCCTTCGGG - Intronic
937968532 2:127532885-127532907 TCTTCTTCCAGAGATCCCACTGG + Intergenic
939944816 2:148396747-148396769 TATTCTTACAGGGTTGCCACAGG + Intronic
947485686 2:230546397-230546419 TTTTGTTACAGGGGCCCCAGAGG - Intergenic
947544886 2:231003517-231003539 TCTTGTTCCAGGGCTCCCACAGG - Intronic
947604028 2:231472342-231472364 TCTTCTTCCAGGGGGCCCGCTGG + Intronic
1172491579 20:35343165-35343187 TTTTCTTACAGAGGTACACCTGG + Intronic
1173686544 20:44927668-44927690 TATTCTTAGAAGGGTTCCACAGG - Intronic
1179447938 21:41446367-41446389 CTTTTTTACAGGGGTACCACAGG + Intronic
1181480157 22:23193773-23193795 TTCTCTCACAGGGGTCCCTGTGG + Intronic
1185158217 22:49207035-49207057 TTTTCTTACAGGGAAACCAGGGG + Intergenic
949556778 3:5160705-5160727 TTTTATTACAGGGGATCAACTGG - Intronic
956057887 3:65319994-65320016 CTTGCTTACAGGGATGCCACTGG - Intergenic
962284520 3:134075093-134075115 TTGTCCTACAGGAGCCCCACTGG - Intronic
964488610 3:157210554-157210576 TTTTCATACAGCGGTCACCCAGG + Intergenic
965028117 3:163328589-163328611 TTTTTTCAAAGGAGTCCCACGGG - Intergenic
969319124 4:6400784-6400806 TTTGCATTCAGGGGTCCCATTGG - Intronic
969903944 4:10375651-10375673 TTTTCTGACAGTGGTCTCCCTGG + Intergenic
974594373 4:63997334-63997356 TTTTTTTTCAGGGGCCCCATGGG + Intergenic
974961513 4:68707585-68707607 TTTTGTTACAGGGATCCCAGTGG - Intergenic
978816230 4:112909041-112909063 TTTTCTTCCAGTCGTCCCAGTGG - Intronic
979365053 4:119812392-119812414 TGATCTTACTGGGGCCCCACTGG + Intergenic
979563651 4:122129260-122129282 TTTCCTTTCAGGGGTCCTCCTGG + Intergenic
983890525 4:173025258-173025280 TCTTGTAACAGGGGTCCCCCTGG - Intronic
984361730 4:178742971-178742993 TTGTCTTACAGGGGTCCTTGGGG - Intergenic
985103794 4:186482771-186482793 TTTTCTGACAGGGGTAACACTGG - Intronic
987660437 5:20865988-20866010 TTTTTTCACATGGGTCCCATGGG + Intergenic
988763212 5:34339695-34339717 TTTTTTCACATGGGTCCCATGGG - Intergenic
989252246 5:39330977-39330999 GTTTCTTAAAGTGGTCCCATTGG - Intronic
994499079 5:100551414-100551436 TTTGCTTACAGGCATGCCACTGG + Intronic
996025221 5:118638309-118638331 TTGTCTCACAGGGGTCCCTGCGG + Intergenic
997718925 5:136062652-136062674 TTTTCTTTCAGGCTTCCCAGAGG + Exonic
1000667409 5:164015655-164015677 TTTTGTTACAGGAGCCCCAGTGG - Intergenic
1005662787 6:28016432-28016454 TTTTCTTAGACATGTCCCACTGG + Intergenic
1006602354 6:35234425-35234447 TGCTCTTACAGGGCTCCCTCAGG + Intronic
1007247856 6:40475303-40475325 TTTTCCTCCAGGGGCCCTACTGG - Intronic
1009438247 6:63643407-63643429 TTTTCTTACGTGGTTCCAACTGG - Intronic
1010407871 6:75525825-75525847 TTTGCTTACAGGGGGTCCACAGG - Intergenic
1010500452 6:76593606-76593628 TTTTCTTGCAGGGGTCCTTGGGG + Intergenic
1012069601 6:94596798-94596820 TTTTCATATATGGCTCCCACTGG - Intergenic
1015989789 6:138926943-138926965 TCATCTTTCAGGGGTCGCACTGG - Intronic
1017650667 6:156578634-156578656 TTTTTTTCCAGGGACCCCACTGG + Intergenic
1022224459 7:28348694-28348716 TTTTCCTAAAGGGTTCCCAAAGG + Intronic
1024669903 7:51585010-51585032 TTTCCCTACAGGGCACCCACTGG + Intergenic
1025761309 7:64397447-64397469 TTTTCTTATAGGGGTTCAATAGG + Intergenic
1026421468 7:70241588-70241610 TTTTCTTACAGGGGTCCCACAGG - Intronic
1026900669 7:74035353-74035375 TTTCCTTTCAGGGGTCCCTGGGG + Exonic
1027875611 7:83764023-83764045 TTTTCTGAAAGTGGTCCCATAGG + Intergenic
1028335585 7:89650201-89650223 TTTTCTTACAGTAGTCTCACAGG + Intergenic
1030269930 7:107660522-107660544 TCTTCTTTAAGGAGTCCCACAGG + Intergenic
1032654859 7:133916675-133916697 TTTTAGTACAGGGGTCACTCTGG - Intronic
1043306293 8:78800730-78800752 TCATCTTACAGGGGTCCAAAAGG + Intronic
1043703016 8:83314030-83314052 TTTTCTTACCCTGGTACCACTGG - Intergenic
1048301796 8:133256733-133256755 TCTTCTTGCAGGGATCCCGCCGG + Intronic
1052864094 9:33454477-33454499 GATTCTTACAAGGGCCCCACCGG - Intergenic
1055427585 9:76212050-76212072 TTTTCTCACAGTGGTCTCAGTGG - Intronic
1055601296 9:77921692-77921714 TTTTCTTTCAGTAGTACCACAGG - Intronic
1062248551 9:135582925-135582947 TTTCCTTCCAGGGATCCCACTGG + Intergenic
1190357293 X:49617435-49617457 TTTTCTTCCAAGGGTCCTAGTGG + Intergenic
1191016986 X:55819367-55819389 TTGTCTCACAGGGGTCCCTGGGG - Intergenic
1191735752 X:64386424-64386446 TTATCTTACACTGGTCCCTCTGG - Intronic
1201226531 Y:11824165-11824187 CTTTCTTACATGGGTCCAGCAGG - Intergenic
1201777538 Y:17682837-17682859 TTTTTTTGCATGGGTCCCACTGG + Intergenic
1201824020 Y:18223155-18223177 TTTTTTTGCATGGGTCCCACTGG - Intergenic