ID: 1026421534

View in Genome Browser
Species Human (GRCh38)
Location 7:70242171-70242193
Sequence GCACGGGCAACCACCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026421534_1026421539 15 Left 1026421534 7:70242171-70242193 CCACCTCAGGTGGTTGCCCGTGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1026421539 7:70242209-70242231 TAAACCTCCATACTGTGTAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1026421534_1026421542 26 Left 1026421534 7:70242171-70242193 CCACCTCAGGTGGTTGCCCGTGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1026421542 7:70242220-70242242 ACTGTGTAGAGGAGATTGTGTGG 0: 1
1: 0
2: 2
3: 30
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026421534 Original CRISPR GCACGGGCAACCACCTGAGG TGG (reversed) Intronic
900771883 1:4551920-4551942 GCACGGGCAAGCGTCTGAGAGGG + Intergenic
902385623 1:16073784-16073806 GCCCGGGCAACCCCAGGAGGTGG - Intergenic
903357865 1:22759103-22759125 GCAAGTGCAAAGACCTGAGGAGG - Intronic
903859047 1:26354257-26354279 GCACAGGCAAGCACCAGGGGAGG - Intergenic
905675015 1:39818873-39818895 CCATGGGCTACCACCTCAGGAGG + Intergenic
919391557 1:196991840-196991862 GGACGGGGACCCACTTGAGGAGG + Intronic
920866730 1:209759431-209759453 GGACTGGTCACCACCTGAGGGGG + Intronic
1064425534 10:15226057-15226079 GCACAAGCAAGCAGCTGAGGTGG + Intronic
1064932247 10:20640741-20640763 GAAATGGCCACCACCTGAGGAGG + Intergenic
1072614032 10:97037802-97037824 GCATGGGGCACCACCAGAGGTGG - Intronic
1075794581 10:125110019-125110041 ACATGGGTGACCACCTGAGGGGG - Intronic
1076367793 10:129933608-129933630 GCACGGGCACCCGCCTGCAGAGG - Intronic
1077073989 11:691689-691711 ACAAGGGCACACACCTGAGGGGG - Intronic
1086864715 11:91966511-91966533 GCATGAGCAAGGACCTGAGGAGG - Intergenic
1093484761 12:19640921-19640943 GCAGGGGGAACCAGATGAGGAGG - Intronic
1095353607 12:41244602-41244624 GCATGGGCAACACTCTGAGGCGG - Intronic
1101736840 12:107469465-107469487 GCACTGGCACCCATCTGATGGGG + Intronic
1106335484 13:28778836-28778858 TCATGGGCAACTACCTGAGCTGG - Intergenic
1107870861 13:44745384-44745406 GCACGGGCAAAGCCCTGAGGTGG - Intergenic
1117119590 14:52553141-52553163 GCACGGACACCCTCATGAGGGGG - Exonic
1202848439 14_GL000225v1_random:1064-1086 GCACAGGCCACCACCTGCGCAGG - Intergenic
1124378051 15:29141064-29141086 CCACGTGCACCCACCTGAGAAGG - Intronic
1126165531 15:45651230-45651252 GCACGGGCCAGCAGCTGCGGAGG - Intronic
1126479204 15:49099325-49099347 GCAAGTGCAACAGCCTGAGGAGG + Intergenic
1127532585 15:59859322-59859344 GCATGAGCCACCACATGAGGGGG - Intergenic
1128213414 15:65917591-65917613 GCCCGGGCAGCCACCTCAGGAGG - Intronic
1131337921 15:91567787-91567809 CCAAGGGCAGCCACCTGATGTGG + Intergenic
1131975860 15:97945333-97945355 TCAAGGGCAGCCACCTGAGAAGG + Intergenic
1132393827 15:101457999-101458021 CCACGGGCAACCATCTGTGAGGG - Intronic
1133020217 16:2963871-2963893 GCGCGTGCGACCACGTGAGGGGG + Intergenic
1140738738 16:77922872-77922894 GCACTGTGAACCACCTGAGTTGG + Intronic
1143873123 17:9971924-9971946 GAACGGGGCACCACCTGAGCAGG - Intronic
1146770361 17:35563139-35563161 ACACTGGGACCCACCTGAGGTGG + Intergenic
1148924335 17:51069985-51070007 GCAGTGGCATGCACCTGAGGTGG + Intronic
1159077858 18:63701693-63701715 GCAGGGGTAACAACCTGGGGAGG + Intronic
1165828072 19:38716960-38716982 GCAGGGGTAACCCCCTAAGGTGG + Intronic
942498740 2:176565996-176566018 GCAGGGCCAAGCACTTGAGGTGG - Intergenic
945934588 2:215890151-215890173 GCATGGGCTAAAACCTGAGGTGG - Intergenic
946247928 2:218397913-218397935 GCACGGGCAACGGCTTGAAGTGG + Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175971626 20:62689481-62689503 CCATGGGCCAGCACCTGAGGAGG - Intergenic
1181745049 22:24950427-24950449 GCAGGGGGAACCAGCTAAGGTGG + Intergenic
954224187 3:49172023-49172045 GAATGGGCAAACTCCTGAGGGGG + Intronic
955632798 3:60992673-60992695 GCACTGGCAATCACCAGAGAGGG - Intronic
959828937 3:110836318-110836340 GCACGGGAACCCACTTGAGGAGG + Intergenic
966009062 3:175053396-175053418 ACACAGCCAACCACCTGGGGAGG - Intronic
973334790 4:48944991-48945013 GCACTGGAAACCACCTGTGCTGG - Intergenic
973982870 4:56320902-56320924 GCACTGGCCTCCCCCTGAGGTGG + Intronic
981133925 4:141189373-141189395 GCACAGGGACCCACTTGAGGAGG + Intronic
982825793 4:160002318-160002340 GCTCAGGGACCCACCTGAGGAGG - Intergenic
989725267 5:44579625-44579647 GGTCGGGCACCCACTTGAGGAGG - Intergenic
996130918 5:119780086-119780108 GGTCAGGCAACCACTTGAGGAGG + Intergenic
999658602 5:153834916-153834938 GCAAAAGCAACCACCTGAGAAGG + Intergenic
1003321604 6:5057278-5057300 GCACGGGCTTCGACCTGAAGGGG + Intergenic
1004970770 6:20907758-20907780 GCACAGCCCACCACCCGAGGTGG + Intronic
1008915736 6:56785162-56785184 GCTCGGGGACCCACCTGAGGAGG + Intronic
1011746621 6:90413141-90413163 GCATGGGCATCCATCTGCGGGGG + Intergenic
1012986749 6:105884055-105884077 GCACAGCCAAGCACCTGAGTTGG + Intergenic
1017185670 6:151598140-151598162 GCAAGGGAAAGCATCTGAGGTGG + Intronic
1021887689 7:25156141-25156163 ACACAGACAAACACCTGAGGAGG + Intronic
1023612136 7:41981820-41981842 GAACTGGCAACCAGCGGAGGAGG + Intronic
1026421534 7:70242171-70242193 GCACGGGCAACCACCTGAGGTGG - Intronic
1026907697 7:74072055-74072077 CCACGAGCAACCAGCTGAGGTGG - Intergenic
1029380536 7:100211518-100211540 GCCTGGGCAACCAGCTGATGCGG + Exonic
1040390174 8:46942842-46942864 GCTCAGGGAACCACTTGAGGAGG - Intergenic
1045847783 8:106658036-106658058 GCACGGCCAACCGCCTGTTGGGG + Intronic
1048271167 8:133029383-133029405 TCAGGGACAACCACCTGAAGGGG + Intronic
1049612355 8:143561520-143561542 GGCCGGGCAGCCCCCTGAGGCGG + Intronic
1054336273 9:63813066-63813088 GCACGGGCGAGCACCTCTGGGGG + Intergenic
1061551326 9:131336450-131336472 GCAGGGGCATCCAACTCAGGTGG + Intergenic
1191273505 X:58511046-58511068 GCTCGGGGACCCACTTGAGGAGG - Intergenic