ID: 1026424521

View in Genome Browser
Species Human (GRCh38)
Location 7:70276887-70276909
Sequence GAGTAAAGAACGTTGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026424521 Original CRISPR GAGTAAAGAACGTTGGTAAC TGG Intronic
914216592 1:145636178-145636200 GGGTAAAGGACTGTGGTAACGGG - Intronic
917169773 1:172158260-172158282 GAGTAGATAAGGTTGATAACTGG + Intronic
1069553801 10:69383452-69383474 GAGTAACGAATGTTTGTGACAGG + Intronic
1073846322 10:107559496-107559518 GAGAATAGAATGTTGGTTACTGG + Intergenic
1087983637 11:104649921-104649943 GAGTAAAGAACTGAGTTAACAGG - Intergenic
1100488931 12:95059409-95059431 GAATAAAGAACTTTGGGACCGGG + Intronic
1101229302 12:102723406-102723428 TAGGAAAGAAGGTTGGTGACAGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1108372717 13:49786964-49786986 GAGGAAGTAAGGTTGGTAACAGG + Intronic
1113155841 13:107320634-107320656 GAGTAAAGAATGTTGGTTTATGG + Intronic
1202935271 14_KI270725v1_random:82127-82149 GAGGGAAGAACGTTGCTACCAGG - Intergenic
1125214725 15:37258403-37258425 GAGTATAGAAGGATGGTTACTGG + Intergenic
1125266471 15:37887007-37887029 ATGTAAAGAACCTTGGTAACAGG + Intergenic
1126942632 15:53783017-53783039 GAGGAAAGAAGGTTGGGAATGGG - Intergenic
1129099256 15:73243634-73243656 TAGTAAAGAACCTAGATAACTGG + Intronic
1134120637 16:11581903-11581925 GAGAAAAGAACTGTGGTTACTGG + Intronic
1135270192 16:21062692-21062714 AAGCAAAGAAAGATGGTAACTGG + Intronic
1140065381 16:71606857-71606879 CAGTAAACAACGTTGGAATCAGG - Intergenic
1144399761 17:14884710-14884732 GTGGAAACAACTTTGGTAACAGG - Intergenic
1153251617 18:3128167-3128189 GAATAAAGGAGGTTGGTAAGTGG - Intronic
1158400625 18:57118240-57118262 AAAAAAAGAAAGTTGGTAACTGG - Intergenic
1159415408 18:68141015-68141037 GAGTTAAGTACCTTGTTAACAGG + Intergenic
1168481500 19:56724057-56724079 GATAAAAGAATGTTGGTATCAGG + Intergenic
1168655472 19:58124474-58124496 TAGTATAGAAAGTTGGTAACAGG - Intergenic
925862880 2:8197460-8197482 GAGTAATGAACGGGGGTACCAGG + Intergenic
928797440 2:35039694-35039716 TAATAAAAAACATTGGTAACAGG + Intergenic
932959130 2:76391375-76391397 CAGTAAAAGATGTTGGTAACAGG - Intergenic
942421117 2:175808988-175809010 GAGGAAAGAACATTTCTAACAGG + Intergenic
943864311 2:192909107-192909129 GAAAAAAGATGGTTGGTAACAGG + Intergenic
947831087 2:233142328-233142350 GAGGAAAGAACGTTGGTCCATGG + Intronic
1169120118 20:3090616-3090638 AAGTAAATAACCTTGGGAACAGG - Intergenic
1169633517 20:7661500-7661522 GAAGAAAGAACATTTGTAACTGG + Intergenic
1170420830 20:16191382-16191404 GTGTAAAGCACCTTGGTACCAGG + Intergenic
1172800486 20:37572994-37573016 GAGGAAGGGACGTTGGTGACTGG + Intergenic
1176596689 21:8704363-8704385 GAGGGAAGAACGTTGCTACCAGG - Intergenic
1183470759 22:38005216-38005238 GAGTGAAGGACGTTGGAAATAGG - Intronic
1185286444 22:50002003-50002025 GAGTAAGGAATGAGGGTAACTGG + Intronic
951631759 3:24729376-24729398 GAGAAAGGAAAGTTGATAACTGG - Intergenic
959258845 3:104049176-104049198 GAGTTAAGAACCTTGATAAAAGG + Intergenic
961092966 3:124131326-124131348 AAGTAAACACAGTTGGTAACTGG - Intronic
963266674 3:143246679-143246701 GAGTAAAGAACATGGGTATGAGG - Intergenic
965463863 3:169002931-169002953 GTGTAAAGAATGTTGGCACCAGG - Intergenic
975314969 4:72941206-72941228 AAGAAAAGAACGTTCTTAACTGG + Intergenic
986069508 5:4268421-4268443 GAGTAAAGAACAGTGGGCACAGG - Intergenic
986581534 5:9271375-9271397 TAATAAAGAAAATTGGTAACAGG + Intronic
989109279 5:37891252-37891274 GAGTAGAGAACGATGGAACCTGG + Intergenic
989494087 5:42090927-42090949 GAGTAAAGAAGGATGAAAACGGG - Intergenic
994819419 5:104629804-104629826 GTTTAAAGAATGTTGGTCACAGG - Intergenic
997199069 5:131998770-131998792 CAGGAAATAACTTTGGTAACAGG - Intronic
999969468 5:156844836-156844858 GAAAAAAGAACGTTGGTTACTGG + Intergenic
1001400495 5:171443648-171443670 GACTAAAGAATGATGATAACAGG - Intronic
1005871137 6:29975116-29975138 GAGGAAAGAACCCTGGGAACGGG + Intergenic
1010161963 6:72867355-72867377 GACCAAAGAAAGTTGTTAACAGG - Intronic
1010417026 6:75624050-75624072 GAGTGGAGAAAGTGGGTAACTGG - Intronic
1018334317 6:162769356-162769378 GAGTAAATAACGTTTGTCCCCGG - Intronic
1022375736 7:29809288-29809310 GTGTAAAGAACGTGGGTTAAGGG + Intronic
1026424521 7:70276887-70276909 GAGTAAAGAACGTTGGTAACTGG + Intronic
1031039874 7:116828265-116828287 AAATAAAGAATGTTGTTAACTGG - Intronic
1045837128 8:106535586-106535608 GAGCAAAGAAAATTGGCAACTGG - Intronic
1051622869 9:19069736-19069758 GAGTAAATAAGATTGGAAACTGG + Intronic
1052266148 9:26576093-26576115 GAGGAGAGAAAGTGGGTAACTGG - Intergenic
1056863086 9:90205200-90205222 GAGTAGAGGATGTTTGTAACAGG + Intergenic
1059149439 9:111936008-111936030 GAGAAAAGAATGTTCTTAACTGG + Intergenic
1059705994 9:116823821-116823843 GAGGAAGGAATGATGGTAACTGG - Intronic
1061089248 9:128417649-128417671 GAGGCAAGAAAGTTAGTAACAGG + Intronic
1199191347 X:144975007-144975029 GATAAAAGAACATTGGTTACAGG + Intergenic