ID: 1026425223

View in Genome Browser
Species Human (GRCh38)
Location 7:70284900-70284922
Sequence CTGCATCTCAGAAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026425223_1026425228 3 Left 1026425223 7:70284900-70284922 CCTTCCTGCTTTCTGAGATGCAG 0: 1
1: 0
2: 8
3: 45
4: 362
Right 1026425228 7:70284926-70284948 TTTGACAGAGAGGTCAAAAAAGG 0: 1
1: 0
2: 3
3: 34
4: 333
1026425223_1026425229 4 Left 1026425223 7:70284900-70284922 CCTTCCTGCTTTCTGAGATGCAG 0: 1
1: 0
2: 8
3: 45
4: 362
Right 1026425229 7:70284927-70284949 TTGACAGAGAGGTCAAAAAAGGG No data
1026425223_1026425227 -7 Left 1026425223 7:70284900-70284922 CCTTCCTGCTTTCTGAGATGCAG 0: 1
1: 0
2: 8
3: 45
4: 362
Right 1026425227 7:70284916-70284938 GATGCAGGGATTTGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026425223 Original CRISPR CTGCATCTCAGAAAGCAGGA AGG (reversed) Intronic
901252772 1:7793802-7793824 CTGGATCTCAAAATGAAGGAAGG + Intronic
901409651 1:9073433-9073455 CTACATTCCAGGAAGCAGGATGG - Intronic
901793456 1:11666773-11666795 TCCCATCTCAGAAAACAGGAGGG - Intronic
902393636 1:16120336-16120358 CTGCAGCTCAGAACCCAGAAAGG + Intergenic
902793695 1:18786305-18786327 CTGCAACCCAGCAAGCAGGAAGG - Intergenic
903768399 1:25749232-25749254 CTGCAGGACAGAAAGAAGGAGGG - Intronic
903769665 1:25755919-25755941 CAGCATCCCAGAGACCAGGAGGG - Intronic
904688647 1:32277395-32277417 CTTGATCTCAGAAAGCAAGTGGG + Intronic
904794699 1:33050729-33050751 CTGCATTTCAGCCAGCAGGAAGG + Intronic
905298410 1:36969259-36969281 CTGCCCCTCAGAAACCAGCAAGG + Intronic
905401736 1:37708625-37708647 CAGCAGCTCAGAGAGCAGGGAGG - Exonic
906135813 1:43500092-43500114 CTGCATCACAGGCAGCAGGGAGG - Intergenic
907025768 1:51116744-51116766 CAGAAACACAGAAAGCAGGAGGG - Intronic
907580773 1:55570617-55570639 CTGCATTTCAGTGAGCTGGAAGG + Intergenic
907961946 1:59292069-59292091 CTGCATAACAGAAACCCGGAAGG - Intergenic
908421610 1:63963829-63963851 CTGCATTCTAGACAGCAGGAAGG - Intronic
912092535 1:106098313-106098335 CAGCATTACAGAAGGCAGGATGG + Intergenic
912683597 1:111744461-111744483 CTGCTCTTCAGAAAGCAGGAGGG + Intronic
913135374 1:115883567-115883589 GTGCAGCCCAGAAGGCAGGATGG + Intergenic
914048556 1:144112621-144112643 CTGTTTCTCAGAAAACAGGTGGG - Intergenic
914130628 1:144852827-144852849 CTGTTTCTCAGAAAACAGGTGGG + Intergenic
915205628 1:154268656-154268678 CTGACCCTCAGAAAGCAGCATGG - Intronic
915558163 1:156671228-156671250 CTGAATCTGAGGGAGCAGGATGG - Exonic
918487761 1:185046460-185046482 CACCATCTCTGAAAGCAAGAAGG - Intronic
920563880 1:206958660-206958682 CTGCAGCTCAGGAGGCAGAAAGG - Exonic
921436815 1:215133379-215133401 CTGCATTTCAGAAGTTAGGAAGG - Intronic
922763147 1:228144735-228144757 CTGCACCTCAGCAAACAGGTAGG + Intronic
922792962 1:228320556-228320578 ATGCATGTCAGATAGGAGGATGG - Intronic
922964109 1:229673814-229673836 CTGAACTCCAGAAAGCAGGAAGG - Intergenic
924654312 1:245959378-245959400 CAACATCTCAGAAGACAGGATGG + Intronic
1062967972 10:1625168-1625190 CTGCACCACAGAAAACAGGCTGG - Intronic
1063851569 10:10198339-10198361 TTGCAGCTCAGACAGCAGGGAGG - Intergenic
1063955994 10:11267713-11267735 CTGCATCTCCCAAAGCATGCTGG + Intronic
1064595803 10:16943569-16943591 CTGCTTCTCAGAAAGCAGAAAGG + Intronic
1064595857 10:16944267-16944289 CTGCTTCTCAGAAAGCAGAAAGG - Intronic
1065530739 10:26667582-26667604 CTGCAGTGCAGAAAGCAGAAAGG - Intergenic
1065581281 10:27174433-27174455 GTTCATTTCAGAATGCAGGAAGG - Intronic
1065924138 10:30421039-30421061 CTGAACTTCAGAAAGCAAGAAGG - Intergenic
1066292402 10:34026416-34026438 CTGCATATCAGCTATCAGGAGGG - Intergenic
1066547652 10:36518301-36518323 CTACCTCACAGAAAGCAGTATGG + Intergenic
1067144726 10:43686787-43686809 CTGCATCTCAGAGGGCATTAAGG + Intergenic
1068834525 10:61539307-61539329 CTGGAGCTCAGAAATCAAGATGG + Intergenic
1071373892 10:84982884-84982906 CTGCATCTCACATGGCAGAAGGG - Intergenic
1071439735 10:85679718-85679740 CTTCTTCTCAGCTAGCAGGATGG - Intronic
1071465177 10:85933170-85933192 TCCCATGTCAGAAAGCAGGAGGG - Intronic
1071715634 10:88092724-88092746 CTACATCTCAGAAAACCTGAGGG + Intergenic
1072147794 10:92658095-92658117 CTCCATCTCAGAAAACAAGAAGG - Intergenic
1073506748 10:104001284-104001306 CTACATCTGAGAAAGAAAGAGGG - Intronic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075177306 10:120177369-120177391 CTGCTTCTCATCAAACAGGAGGG - Intergenic
1075372663 10:121950939-121950961 CTCCATCTCAAAAAAAAGGATGG - Intergenic
1075954485 10:126510278-126510300 CTGGGTCTCAGAAACCAAGAAGG + Intronic
1076160579 10:128241305-128241327 CTGCATGTCAGAAGGCAGAAAGG - Intergenic
1076503336 10:130954422-130954444 CAGCATCCCACAGAGCAGGAGGG - Intergenic
1077268363 11:1663507-1663529 CTGCATCCTGGGAAGCAGGAAGG + Intergenic
1077272516 11:1688111-1688133 CTGCATCCTGGGAAGCAGGAAGG - Intergenic
1078097705 11:8310848-8310870 CTGCTTCTCTGGAAGCAGAAAGG + Intergenic
1078210510 11:9265841-9265863 CTGAGTCTCAGAAAGAAGCAAGG + Intergenic
1078442518 11:11379171-11379193 GTGCGTCACAGCAAGCAGGAAGG - Exonic
1078932764 11:15925332-15925354 CTGCATTCCAGAAAACAAGATGG - Intergenic
1080326806 11:31084480-31084502 CTTCATTTTAGAAAGCAGGAAGG - Intronic
1080771316 11:35344758-35344780 TTGAAGCTGAGAAAGCAGGAAGG - Intronic
1083755169 11:64788345-64788367 CTGCAGCCCAGGAGGCAGGATGG - Intergenic
1084191966 11:67503541-67503563 CAGAATCTCATAAAGCAAGAGGG - Intronic
1085074126 11:73574566-73574588 CTCCATCTCAGAAAAAAAGATGG - Intronic
1085825638 11:79844192-79844214 ATGTATATCAGAAGGCAGGAGGG - Intergenic
1086016401 11:82172738-82172760 CTGTATTTCAGAAGGAAGGAAGG + Intergenic
1086175204 11:83883755-83883777 CTGCATCTCAGAAAGCAATAAGG + Intronic
1089067942 11:115676264-115676286 GTGCATCTCAGGATGCAAGAGGG - Intergenic
1090340969 11:126019906-126019928 TTTCATCTCAGAAAGCAGCTGGG + Intronic
1090652506 11:128819780-128819802 CTGCATCTCAAAAGGCACAAGGG - Intergenic
1091113771 11:132995098-132995120 CTGCAACTAAGAAAGTAGAAAGG + Intronic
1091224705 11:133950515-133950537 ATCCTTCTCAGAAAGCAGGTGGG + Intronic
1091413801 12:262732-262754 CTGCGTCTCAGACTGCAGGTTGG - Intronic
1093680118 12:21992926-21992948 CTGCATCTTAAGCAGCAGGAAGG + Intergenic
1096620040 12:52858753-52858775 CTGCAGCCCAGCAGGCAGGAGGG - Intergenic
1097533749 12:60839109-60839131 CTGCATGGCAGAAGGCAGAAGGG + Intergenic
1099670162 12:85681095-85681117 CTGGAGCTCAGCAAGCAGAAGGG - Intergenic
1100493530 12:95103539-95103561 CTCCATCTCAGAAAGAATGGAGG - Intronic
1100745424 12:97640479-97640501 AGGCATGTGAGAAAGCAGGAAGG - Intergenic
1100943171 12:99747289-99747311 CTGCAACTCAGAAAACAAGAAGG - Intronic
1101613791 12:106316410-106316432 CTGAAGCACAGCAAGCAGGAGGG - Intronic
1102419565 12:112793007-112793029 GTTCATCTCAGAAGGAAGGAGGG + Intronic
1103937960 12:124486455-124486477 CTGGAACTCAGACAGCAGGGAGG + Exonic
1103976227 12:124704673-124704695 CTGCCACTGAGCAAGCAGGAAGG + Intergenic
1104429989 12:128708368-128708390 CTCAAACTCAGCAAGCAGGAGGG + Intergenic
1105837761 13:24225522-24225544 CTGCATTACAGCAAGCAGGGGGG + Intronic
1106123801 13:26883436-26883458 GTTCAACTCAGAAAACAGGATGG - Intergenic
1106875656 13:34069656-34069678 CTCCATGGCAGAAGGCAGGAGGG - Intergenic
1107644919 13:42484133-42484155 CTACATCTCAGTCAGCAGAAAGG - Intergenic
1108499764 13:51059408-51059430 CTATATCTCAGAGAGGAGGAAGG + Intergenic
1108734036 13:53263833-53263855 TTTCAGGTCAGAAAGCAGGAGGG - Intergenic
1110173714 13:72532262-72532284 CTGGTTCTCAGAAGGCAGCATGG - Intergenic
1112299751 13:98219182-98219204 CTCCATCTCAGAAAAAGGGACGG + Intronic
1112331779 13:98482593-98482615 CAGGATCTCAGAAAGCAGACTGG + Intronic
1112837559 13:103534481-103534503 CTGTATCTCAGAAAGCAGTTAGG + Intergenic
1113263337 13:108590854-108590876 CTGCATCTCTGAAATCAAGGGGG - Intergenic
1114967608 14:27982669-27982691 CTGCATATAATAAAGCAGTATGG - Intergenic
1115573145 14:34686067-34686089 CTGTAGCCCAGAAAGCAAGAGGG + Intergenic
1116739013 14:48731369-48731391 CTGCCTCTAAGAAAGCAGCAGGG + Intergenic
1116865441 14:50028021-50028043 GTGCATCTCACATAGCAGCAAGG + Intergenic
1117457763 14:55914820-55914842 CTGTATCCCAGGCAGCAGGAAGG + Intergenic
1118116789 14:62786944-62786966 TTGTGTCTCAGAAAACAGGAAGG - Intronic
1119772079 14:77226293-77226315 CAGCATCTGGGAAAGCAGGAAGG + Intronic
1119952292 14:78757599-78757621 CTGCATTTCCCAAAGGAGGATGG + Intronic
1121010945 14:90519914-90519936 CTGCATCTCAGCAAGGTCGAGGG - Intergenic
1121737861 14:96231159-96231181 CTCCCTTGCAGAAAGCAGGATGG + Intronic
1122020529 14:98834279-98834301 CTGCATGTTAGACAGTAGGAAGG - Intergenic
1122277568 14:100603042-100603064 CTTCATTCCAGATAGCAGGAAGG - Intergenic
1122336430 14:100991039-100991061 CTCCATCTCAAAAAGAAAGAAGG - Intergenic
1122404285 14:101490688-101490710 GTGCATGTCAGAAAGGAGGATGG + Intergenic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1125492308 15:40157491-40157513 CTGCATCTCAAAAAAGAGGCTGG + Intergenic
1125795506 15:42401585-42401607 CTGCCTCTCAGAGGGCAGGAAGG - Intronic
1126486582 15:49187923-49187945 CTGCATCACAGTAACCAGGCTGG + Intronic
1126796783 15:52266081-52266103 ATGGATCACAGAAAGCAGGGAGG - Intronic
1127620795 15:60732342-60732364 CTGCCTCTCAGGAATCTGGAAGG - Intronic
1128863294 15:71092622-71092644 TTACATCTCAGTAAGCTGGAAGG + Intergenic
1128978969 15:72173026-72173048 CTGCATCCCAGACTGAAGGATGG + Intronic
1129460213 15:75696769-75696791 CTAGATCTCAGGAAGAAGGATGG - Intronic
1131223026 15:90600973-90600995 GTGGAACTCAGAAAGCTGGAGGG + Intronic
1131975904 15:97945730-97945752 CTGCAGCTCAGAGAGCGAGATGG - Intergenic
1131975960 15:97946182-97946204 CCTCATTTCAGAAAGAAGGACGG + Intergenic
1132336313 15:101050647-101050669 CTGCATCCCAGACAGCATCAGGG + Intronic
1132467131 16:82513-82535 CTACTGCTCAGAAAGCCGGAGGG + Intronic
1132687457 16:1168310-1168332 CTGCAGTTCCCAAAGCAGGAAGG + Intronic
1132997682 16:2831703-2831725 CTGCATCCCGGGAAGGAGGATGG + Intronic
1133070240 16:3241958-3241980 CTGCATTTCAGGAAGCAGATGGG - Intergenic
1133861420 16:9598847-9598869 CTGAGTCTCAGAAAGCTGAAGGG - Intergenic
1134370101 16:13615360-13615382 CTGCATTCCAGTTAGCAGGAAGG - Intergenic
1136154246 16:28372240-28372262 CTGCATCTCAAAAAAAAGGGGGG + Intergenic
1136208844 16:28743022-28743044 CTGCATCTCAAAAAAAAGGGGGG - Intergenic
1136363714 16:29798661-29798683 CTGCAGCTCACAAGGGAGGAGGG + Exonic
1138597979 16:58039423-58039445 CTCCATCTCAAAAAGAAAGAAGG + Intronic
1139959318 16:70708694-70708716 CTGAAGCTGAGATAGCAGGAAGG + Intronic
1140850372 16:78929882-78929904 CTGCTTCTAAGAAAGAAGGATGG - Intronic
1141299788 16:82803344-82803366 CTTTATCTCAGAATTCAGGAAGG + Intronic
1141393598 16:83685053-83685075 CTGCATTCCAGACAGCAGGATGG + Intronic
1141506700 16:84482786-84482808 CTGCAGCTCAGGAAGCAACAGGG + Intronic
1141803385 16:86325633-86325655 CTACATCCCAGGCAGCAGGAGGG - Intergenic
1142594174 17:1021453-1021475 CGGCATCCCAGAATGCGGGAGGG + Intronic
1142815197 17:2419789-2419811 CTGTAACTCAAAAAGCGGGAAGG + Exonic
1143437574 17:6940521-6940543 CTGCCTCGCAGAAAAAAGGAGGG + Intronic
1143901448 17:10177576-10177598 CTCCATCTGAGAAGGCTGGAGGG - Intronic
1144515302 17:15913400-15913422 CTGCAGCTCTGAAACCAGGCTGG - Intergenic
1144673585 17:17146743-17146765 TAGCAGCTCAGGAAGCAGGAAGG - Intronic
1145900124 17:28485197-28485219 CTGGAGCTCAGAAACCAGCAGGG - Intronic
1146039258 17:29435178-29435200 CTGCATCTCAGAAAGAACAACGG - Intronic
1146287113 17:31581491-31581513 CTGCTTCCCAGAAAGCAGCATGG + Intergenic
1146540149 17:33686766-33686788 CTGCTTCCCAGAAGTCAGGATGG - Intronic
1146651349 17:34608669-34608691 CCTCCTCTCAGAAATCAGGATGG + Intronic
1147867044 17:43559960-43559982 CTCCATCCCAGAAGGGAGGATGG - Intronic
1148468891 17:47881269-47881291 CTGCTTATCAGAAATCAGGATGG - Intergenic
1148618230 17:49015506-49015528 CCCCATCTCAGATTGCAGGAGGG + Intronic
1150466292 17:65395605-65395627 CTGCATTGCAGCCAGCAGGAAGG - Intergenic
1150688077 17:67336680-67336702 CTGCATCACAGAAGGCAGTATGG + Intergenic
1151324351 17:73369663-73369685 CTCCATCTCAAAAAACAGAAAGG - Intronic
1151516585 17:74600062-74600084 TTACATATAAGAAAGCAGGAAGG + Intergenic
1152218280 17:79047020-79047042 TGGCATTTCAGAAAGCAGGCTGG - Intronic
1152609318 17:81307833-81307855 CTGCATTCCAGGCAGCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155018147 18:21866658-21866680 CTGCAGCTCAGAAAACAGAAAGG - Exonic
1156811306 18:41255752-41255774 CTGCATCTTTGCAAGCAGGAGGG - Intergenic
1157112936 18:44838048-44838070 CTTCATTACAGAAAGGAGGAGGG - Intronic
1157350438 18:46879886-46879908 CAGAATCTTAGAAAGCAAGATGG + Intronic
1159368030 18:67494934-67494956 CTGCATTCCAGGAAGCTGGAAGG - Intergenic
1159727189 18:71975856-71975878 TTGCCTATCAGAAGGCAGGAGGG - Intergenic
1160062933 18:75549004-75549026 CAGCATCCCAGGAAGGAGGAAGG - Intergenic
1160410925 18:78675019-78675041 CTGCCTCTCTGAGAGCAGGAAGG + Intergenic
1160619657 18:80161852-80161874 CTGCATTTCAGTGAGCAGGCAGG + Intronic
1160714948 19:572315-572337 TTGCAACTTTGAAAGCAGGAAGG + Intronic
1162845953 19:13392747-13392769 CTCCATCTCAAAAAGAAGAAAGG - Intronic
1163240258 19:16058327-16058349 CTGCATCTCAAAAAAAATGAGGG + Intergenic
1163658129 19:18560009-18560031 CTCCATCTCGAAAAGAAGGAAGG - Exonic
1163680042 19:18676027-18676049 CAGGATCTTGGAAAGCAGGATGG + Intergenic
1164111382 19:22162640-22162662 CTGCAGCTCAGAAAACAGAAAGG + Intergenic
1164195840 19:22958044-22958066 CTGCAGCTCAGAAAACAGAAAGG + Intergenic
1165402205 19:35608904-35608926 CAGGATCTAAGAAAGCAGGAAGG + Intergenic
1168483006 19:56737163-56737185 CTGCATTTTACAAAGGAGGATGG - Intergenic
1202688009 1_KI270712v1_random:65520-65542 CTGTTTCTCAGAAAACAGGTGGG - Intergenic
925190050 2:1875307-1875329 CTGGATTTCAGAAAACAGGGAGG + Intronic
925683414 2:6447023-6447045 TAGCTTCTCAAAAAGCAGGAAGG - Intergenic
925829584 2:7881449-7881471 CAGCATCTCGGAAAGCAGAAGGG + Intergenic
925927472 2:8680576-8680598 TTGCATTTCAGAAAGCGGAAGGG - Intronic
926802014 2:16666801-16666823 CTGGATCTCAGAAAGGAGAGGGG - Intergenic
927166714 2:20330430-20330452 GTCCATCTCTGGAAGCAGGAGGG - Intronic
927860876 2:26559201-26559223 CTGAATCTCAGGAAGCAGAGAGG + Intergenic
928137197 2:28696531-28696553 CTGCATGTCAGATAGAAGGTGGG - Intergenic
929668131 2:43849659-43849681 TTCCCACTCAGAAAGCAGGAAGG - Intronic
930851261 2:55963258-55963280 GTGCTTCTAAGAAGGCAGGATGG + Intergenic
931214176 2:60226058-60226080 CTGGATGTCAGAAAGGAGGCAGG + Intergenic
931463441 2:62467359-62467381 CTGCAGCCCAGAAAGGAGAAAGG + Intergenic
931709164 2:64972949-64972971 CTGCATCTCAAGCAGGAGGAAGG - Intergenic
933802534 2:85974689-85974711 CTGCAAGTCAGAAAGCAGGAAGG - Intergenic
933958344 2:87390082-87390104 CTGTTTCTCAGAAAACAGGTGGG + Intergenic
934242470 2:90281999-90282021 CTGTTTCTCAGAAAACAGGTGGG + Intergenic
934270705 2:91534684-91534706 CTGTTTCTCAGAAAACAGGTGGG - Intergenic
935344136 2:102089297-102089319 TTGCATCTCAGAGAATAGGAAGG + Intronic
937277438 2:120694448-120694470 CTGCTGCTTAGAAAACAGGAAGG - Intergenic
937407662 2:121645646-121645668 GTGAATCTAAGTAAGCAGGAAGG + Intronic
938150575 2:128879255-128879277 CAGCAGCTCAGAAAGGAGGGAGG - Intergenic
938892566 2:135720339-135720361 CTTCATAACAGAAAGCAGCAAGG - Intronic
939712774 2:145543490-145543512 CAGAAACTAAGAAAGCAGGATGG + Intergenic
940345532 2:152624161-152624183 CTCCATCTCAAAAAAGAGGAAGG - Intronic
940613120 2:156015667-156015689 TTGCATCTCAGAAATCAGGGAGG - Intergenic
942140310 2:172970878-172970900 CTGCACCTGCGAAACCAGGACGG - Intronic
942189519 2:173456460-173456482 CTCCATCTCAAAAAGAAAGAAGG - Intergenic
942626790 2:177909704-177909726 CTATATCACAGAAAGAAGGAAGG - Intronic
942710801 2:178833507-178833529 CTGCATGTCATACAGCAAGATGG - Exonic
943689278 2:190852627-190852649 CTCTCTCTAAGAAAGCAGGATGG + Intergenic
944838882 2:203606750-203606772 CTGCATCTCAAAAAACAAAAAGG - Intergenic
945412657 2:209530175-209530197 ATGCATCCCAGATAGCAGGAGGG + Intronic
945682074 2:212926341-212926363 CTCCATCTCAGGAAGCCAGAAGG + Intergenic
946243582 2:218372264-218372286 CTGCATGTATTAAAGCAGGAAGG - Intergenic
946432184 2:219631778-219631800 CTGAAGCTCAGAAAGAGGGAAGG - Intronic
947499533 2:230661790-230661812 CTGCATCTGAGAAATGAGTATGG + Intergenic
947506903 2:230713963-230713985 CTGCCTCGCAGAAACCTGGAAGG + Intronic
947751101 2:232532899-232532921 CTGCAACTCAGAAGGAAGAAGGG + Intronic
947996311 2:234530645-234530667 CTGCATTGCAGAAGGGAGGAGGG - Intergenic
948528064 2:238585547-238585569 CTCCCTCTCAGAAAGGAGCATGG - Intergenic
948546344 2:238731890-238731912 CTGAATTTGAGAAAGCTGGAAGG + Intergenic
948628187 2:239283582-239283604 CTGCAGTACAGAAATCAGGAAGG + Intronic
948857077 2:240735219-240735241 CTGGGTCTGAGAAAGGAGGAAGG - Intronic
1169098069 20:2921147-2921169 TCTCATCTCTGAAAGCAGGAGGG + Intronic
1169202040 20:3715902-3715924 CTGCATTCGGGAAAGCAGGATGG + Intergenic
1169637432 20:7707773-7707795 ATGCTGCTCTGAAAGCAGGAAGG - Intergenic
1170508955 20:17057467-17057489 CTGCATCCCAGAAGGCTGGTGGG + Intergenic
1170823494 20:19773733-19773755 ATGCACCTCAGCCAGCAGGAAGG - Intergenic
1170973066 20:21134557-21134579 CAGCATGTCAGAAAGCTCGACGG - Intronic
1171047411 20:21823462-21823484 CTGCATTCCAGACAACAGGAAGG + Intergenic
1171495829 20:25554427-25554449 GTGCATCTCAGACAACAGAATGG + Intronic
1173866904 20:46318019-46318041 CGGCAGCTCAGACAGAAGGAAGG - Intergenic
1174311884 20:49662591-49662613 GTTCCTCTCAGAAAGGAGGAGGG - Intronic
1174517587 20:51104626-51104648 GGGCATCTCAGAAAGCAATAAGG + Intergenic
1175196236 20:57245094-57245116 CTTCATTTCTGAAAACAGGAAGG + Intronic
1177036735 21:16053976-16053998 CTGCATTTCAGCCATCAGGATGG + Intergenic
1177510425 21:22079890-22079912 GTGCATATCAGAGAGCAGGAAGG - Intergenic
1177708845 21:24743987-24744009 CTGCAAGTCAGAAAGCAGCATGG - Intergenic
1178386928 21:32159974-32159996 CTGGATCTGAGAAGGAAGGAAGG + Intergenic
1178710532 21:34912672-34912694 CTGCATCTCAAAGACTAGGAAGG - Intronic
1178717222 21:34976609-34976631 CTGCGTCACAGAAGGGAGGACGG + Intronic
1179027598 21:37692626-37692648 CTCTATTTCAGAGAGCAGGAAGG - Intronic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1180924819 22:19546078-19546100 CAGTATCTCACAAAGCAGAACGG + Intergenic
1181063280 22:20292165-20292187 CTGAAGCTCAGAGAGGAGGAGGG - Intergenic
1181326147 22:22048069-22048091 CTTCATCCCAGGATGCAGGATGG - Intergenic
1181350602 22:22254941-22254963 CTGTTTCTCAGAAAACAGGTGGG - Intergenic
1182149954 22:28020933-28020955 CTGCCTCGCAGAAGGCAGGGCGG - Intronic
1182584345 22:31335394-31335416 CTGCTACTCAGATGGCAGGATGG - Intronic
1182837472 22:33355680-33355702 CTGGGCCTCAGAAAGCCGGAGGG - Intronic
1183778459 22:39983404-39983426 CTGGATCTCAGAATGAAAGAAGG - Intergenic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184123889 22:42472973-42472995 CAGCATCTCAGAAAGGAGCAGGG + Intergenic
1184253323 22:43273247-43273269 AAGCTTCTCCGAAAGCAGGATGG + Intronic
1184572868 22:45337703-45337725 CTCCATCTCAGAGAGAAGGAGGG - Intronic
1185104867 22:48861931-48861953 CTGCATCAGAGCAAACAGGATGG + Intergenic
1185109274 22:48891938-48891960 CTGCATCCCAGCTAGCTGGAAGG + Intergenic
1185202746 22:49518036-49518058 GTGCATGACAGAATGCAGGAGGG - Intronic
950504857 3:13388351-13388373 CTTCATCCCAGACACCAGGATGG + Exonic
950875405 3:16266884-16266906 CTGAAGATTAGAAAGCAGGAAGG + Intronic
952772992 3:37019172-37019194 CTGCATCTCAGTGAGTAGGTGGG - Intronic
954597869 3:51842251-51842273 CTGCAGTTCAGAAAGAAGAAGGG - Intergenic
954623252 3:52007540-52007562 CTGCAGCTCCGACAGCAGCATGG + Intergenic
955065042 3:55526724-55526746 CAGCATCACAGGAAGCACGAGGG + Intronic
955576158 3:60366180-60366202 CTCCATCTCAAAAAGGCGGAGGG - Intronic
955737790 3:62058153-62058175 GTACAATTCAGAAAGCAGGACGG + Intronic
958085834 3:88805076-88805098 GTGCATCTCAGAAAGAAGGATGG + Intergenic
958951368 3:100420317-100420339 CACCATCTCAAAAAGAAGGAAGG - Intronic
960650836 3:119947763-119947785 CTGCATCTTAGAAAACAATAAGG - Intronic
960798903 3:121517685-121517707 CTGCATTTCAGCCATCAGGAAGG - Intronic
960994387 3:123331321-123331343 CTGCAGCTCAGCCAGCAGGGTGG + Intronic
961671514 3:128535278-128535300 CTGCATGTCAGGCAGCAGGATGG - Intergenic
962837011 3:139198501-139198523 CTGCATCACAGCCAGCATGAAGG - Intronic
963319334 3:143796080-143796102 CTGCATCTCAAAAACCACGTGGG + Intronic
963764193 3:149316730-149316752 CTTCATCTCACAAAGCAGGAAGG + Intergenic
963767520 3:149352967-149352989 CTGCAACTCAGAAAACATAAAGG + Intergenic
963845558 3:150152620-150152642 CTGCATCTCTGAGATCAGAAGGG - Intergenic
963981104 3:151537986-151538008 CTGAAACTGAGGAAGCAGGAGGG - Intergenic
964946259 3:162228677-162228699 CTGCTTCTCAGAAAGAAAGCAGG - Intergenic
965693445 3:171381815-171381837 CTGCATTCCAGGCAGCAGGAAGG - Intronic
966104592 3:176321456-176321478 CTGCATTTCACAAAGAAGGTAGG + Intergenic
966986622 3:185186224-185186246 CTGCATCTCAGACAGCTGTGAGG - Intergenic
967276377 3:187779395-187779417 CTCCACCTCAGAAATCAGAAAGG - Intergenic
967693547 3:192504938-192504960 CTGGAACTCAGAATGAAGGAGGG + Intronic
968445155 4:648750-648772 CTGCAGCTCAGACAGCTGGGCGG - Intronic
968601299 4:1511190-1511212 CTGCAGCTCAGGAAACAGGAAGG - Intergenic
968685899 4:1958415-1958437 CTGTACCTCAGAGAGCAAGATGG + Intronic
969218547 4:5743673-5743695 CTGCATCCCAGGAAGGAGGAAGG + Intronic
969422869 4:7107521-7107543 CAGTGTCTCAGAAAGCTGGAAGG - Intergenic
969902761 4:10364848-10364870 CTGTATCACAGAAAACATGAAGG - Intergenic
970738213 4:19198953-19198975 ATGAATGTCAGATAGCAGGAAGG - Intergenic
971725837 4:30310809-30310831 CTGCATCGCATATAGTAGGATGG - Intergenic
972285675 4:37645581-37645603 CTGCATATTAGAAGACAGGAGGG + Intronic
973565936 4:52187375-52187397 GTGCAGCTCAGAATGAAGGATGG + Intergenic
973730088 4:53814893-53814915 CTGCCTCCCAGCCAGCAGGAAGG - Intronic
974156953 4:58085869-58085891 ATTCATGGCAGAAAGCAGGAAGG + Intergenic
974423323 4:61707048-61707070 CTGTGTCTCAGGAATCAGGAAGG + Intronic
976147938 4:82061620-82061642 ATGCAGCTCAGAAAACATGAAGG - Intergenic
976339586 4:83932223-83932245 CTGCATCTCAGAGAGTTGCACGG - Intergenic
977346518 4:95823370-95823392 CTGCTTCTCAGGGAGCAAGATGG - Intergenic
978554968 4:109970181-109970203 CTGAATGGCAGGAAGCAGGAAGG + Intronic
979314034 4:119238331-119238353 CTGCATCTCAGGGAGTAGGGAGG + Intronic
981007331 4:139889406-139889428 CTGCTTCTCATGAAGCAGAAAGG - Exonic
981102868 4:140849724-140849746 CAGCATTTCAGAAAACAGGATGG + Intergenic
981109125 4:140915532-140915554 CTACTTCTCACAAAGCATGAAGG - Intronic
984027446 4:174560102-174560124 CTGCATCTGAGAAACCAGCAGGG - Intergenic
984183890 4:176518963-176518985 CTGTGTCTCAGAAGGCAGGATGG - Intergenic
984692165 4:182739367-182739389 CTGCATCTCAGACAACCTGAAGG + Intronic
985351268 4:189064757-189064779 AGGAATCTCAGAATGCAGGATGG - Intergenic
985367614 4:189248934-189248956 TGGCATCCCAGAAAGCAAGAGGG + Intergenic
985850561 5:2385611-2385633 ATTTATGTCAGAAAGCAGGAGGG - Intergenic
987204887 5:15614829-15614851 CTGCTTCAAAGACAGCAGGAAGG + Intronic
988713269 5:33799737-33799759 GTGAATATCTGAAAGCAGGATGG + Intronic
990284597 5:54288339-54288361 CTGCATTCCAGATAGCTGGATGG - Intronic
994551649 5:101241392-101241414 CTGCTTCTCAGACTGCTGGAGGG - Intergenic
994572528 5:101532479-101532501 CTGAATTTCAGAAGTCAGGATGG - Intergenic
995458716 5:112379601-112379623 TTGCAGATGAGAAAGCAGGAGGG - Intronic
998150276 5:139753188-139753210 CTGCAGCTCAGGAAGCACGTGGG - Intergenic
998339194 5:141401334-141401356 CTCCATCTCAAAAAAAAGGAAGG + Intronic
1001108740 5:168877622-168877644 ATTAATCTCAGGAAGCAGGAGGG + Intronic
1002666673 5:180830607-180830629 CTTAATCTCAGACAGCTGGAAGG - Intergenic
1002666689 5:180830707-180830729 CTTAATCTCAGACAGCTGGAAGG - Intergenic
1003383071 6:5642582-5642604 CAGCATCTCAGGAAGAAGAATGG + Intronic
1003683431 6:8278009-8278031 CTGCAAAGCAGAAAGCAGGCAGG - Intergenic
1004371582 6:15057240-15057262 TTGCATCTCAGAGAACAGGAAGG + Intergenic
1005023617 6:21441578-21441600 CAGCACCACAGTAAGCAGGAGGG - Intergenic
1008821712 6:55640070-55640092 CTCCATCTCAAAAAGAAAGAAGG + Intergenic
1012923438 6:105244146-105244168 CTGATTGTCTGAAAGCAGGAGGG + Intergenic
1016309272 6:142715753-142715775 CTACATTTTAGAAACCAGGAAGG - Intergenic
1017185756 6:151598676-151598698 TATCATCTCAGAAAGAAGGAGGG + Intronic
1019337276 7:491392-491414 CTCCAGCTCAGAAACCAGAAGGG + Intergenic
1019618211 7:1976512-1976534 CTACATCTCATAAAGCAGTGCGG + Intronic
1020061458 7:5155656-5155678 CACCTTCTCAGGAAGCAGGATGG + Intergenic
1020112326 7:5454576-5454598 CTGCTTCTCAGAAATCAGTCTGG - Intronic
1020166698 7:5813000-5813022 CACCTTCTCAGGAAGCAGGATGG - Intergenic
1021142565 7:17045504-17045526 CTGCATTCCAGGTAGCAGGATGG - Intergenic
1021161940 7:17284846-17284868 CTCCATCTCAGAAAAAAGGCCGG - Intergenic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1022367497 7:29738382-29738404 CTGCATCCCAAATAGCGGGATGG - Intergenic
1022381543 7:29865311-29865333 CTGCATTTCAGAAAGCATCTGGG - Intronic
1023115367 7:36856722-36856744 CAGCATCTCAGAAAGCTGCTTGG + Intronic
1023719013 7:43073702-43073724 CTGCAGCTCAGAAAGAACAAAGG - Intergenic
1023803122 7:43852062-43852084 CTGTAGTTCAGCAAGCAGGAGGG - Intergenic
1024001837 7:45194920-45194942 CACCATCTCAGAAAACAGTAAGG - Intergenic
1024394733 7:48853007-48853029 CTGCAACACAGAAATCTGGAAGG - Intergenic
1026146735 7:67752975-67752997 CCCTATCTCAGAAAGAAGGAAGG + Intergenic
1026268638 7:68817369-68817391 CTGCATCCTAGGCAGCAGGAAGG + Intergenic
1026425223 7:70284900-70284922 CTGCATCTCAGAAAGCAGGAAGG - Intronic
1027361956 7:77418032-77418054 CTGCATTCCAGAAATCAGAATGG + Intergenic
1028639135 7:93023550-93023572 CTGCATCTCACTAGGCAGAAAGG + Intergenic
1028760112 7:94486530-94486552 CTGCATCTTAGAAGGCGGCATGG - Intergenic
1030335806 7:108324589-108324611 CTGCATCACAGAATGGATGAAGG + Intronic
1030583011 7:111383656-111383678 CAGAATCCCAGAAGGCAGGAGGG + Intronic
1030728508 7:112955820-112955842 CTGCATCTTAGAAGCCAAGAAGG - Intergenic
1030873810 7:114788918-114788940 CATCATCGCAGAAAGCAAGAAGG + Intergenic
1030929825 7:115508500-115508522 CTGCAGCTCTGCAATCAGGAAGG - Intergenic
1032481968 7:132254637-132254659 CTGCAGCCTAGAAAGCATGAAGG - Intronic
1033026595 7:137780376-137780398 CTGCATCTCAGAAAGAGGTCTGG + Intronic
1035073373 7:156160673-156160695 CTCCATCTCAGAAAGAAGGAAGG + Intergenic
1036463380 8:8974037-8974059 CTGCATCCCAGGAAGCAGGGTGG - Intergenic
1037469281 8:19191491-19191513 CACAATCACAGAAAGCAGGATGG + Intergenic
1039968791 8:42304367-42304389 CTGCAGCTCAGATGGCAAGAAGG - Intronic
1041449908 8:57995011-57995033 CGGCAGCCCAGAAAGCCGGACGG - Intronic
1042229301 8:66540580-66540602 AGGCATCTCAGAACACAGGATGG - Intergenic
1042301795 8:67290882-67290904 ATGCCTCTCAGAAAGCTGGGGGG + Intronic
1044726795 8:95200843-95200865 CTGCACCCCAGAAAGCCTGAGGG - Intergenic
1045485794 8:102629951-102629973 CTCCACCTCAGGAAGCATGAAGG - Intergenic
1045941178 8:107739932-107739954 TTGCATTTCAGACAGCAGGATGG + Intergenic
1047191888 8:122685909-122685931 CTGGATCCCAGGCAGCAGGAAGG - Intergenic
1047915918 8:129583580-129583602 TTGCATTTCATAAAGCAGTATGG - Intergenic
1047967482 8:130057012-130057034 CTGCAGCTCAGGCATCAGGAGGG - Intronic
1048589754 8:135810483-135810505 CTACATCTCTGAAAGCAGGTGGG - Intergenic
1049016016 8:139920598-139920620 TTACAATTCAGAAAGCAGGAGGG - Intronic
1049211229 8:141387287-141387309 CTGGAGCTCAGCAGGCAGGAGGG - Intergenic
1049239840 8:141531773-141531795 CTGCTTCCCAGAAAGGAGGTGGG + Intergenic
1049444099 8:142622204-142622226 CAGCACCTCAGAGAGCAGGCGGG - Intergenic
1049534771 8:143173809-143173831 CTCCATCTAAGAAAGAAAGAAGG + Intergenic
1049698782 8:143997071-143997093 CTGCTTCCCAGGCAGCAGGATGG + Intronic
1049957181 9:704398-704420 CTGCATTCCAGGCAGCAGGATGG + Intronic
1050342030 9:4649961-4649983 CTGAATCTTAAAAAGCAGGAAGG - Intronic
1050582965 9:7080258-7080280 CTCCATTTCAGAAAACAGTAAGG - Intergenic
1052055448 9:23902079-23902101 ATGCATCTAAGAAAGTGGGAAGG - Intergenic
1053274074 9:36770398-36770420 CTGCCTTCCAGAGAGCAGGAGGG + Intergenic
1053286444 9:36852376-36852398 CTGAGTCTCAGAAAGGAGAAGGG + Intronic
1056814203 9:89789816-89789838 TTGCATTTCAGGCAGCAGGAAGG + Intergenic
1057052828 9:91938613-91938635 CTTCATCTCAAAAAGGAAGAAGG + Intronic
1057203551 9:93156941-93156963 TTGCATCCCAGCCAGCAGGAAGG + Intergenic
1057250849 9:93500415-93500437 CTGGATCTCACAAATCAGAAGGG - Intronic
1057367059 9:94432612-94432634 GTGAAACTCAGGAAGCAGGAAGG - Intronic
1057445547 9:95111972-95111994 CCCCATCTCAGAAGGCAGGGAGG - Intronic
1057656275 9:96955458-96955480 GTGAAACTCAGGAAGCAGGAAGG + Intronic
1057956446 9:99412023-99412045 CCGCATGTCAGAAATCAGCATGG - Intergenic
1058819073 9:108712532-108712554 CTGCATCCTAGTCAGCAGGAGGG - Intergenic
1059960334 9:119558440-119558462 CAGCATCTGGGGAAGCAGGAGGG + Intergenic
1060219472 9:121756778-121756800 CAGCCTCTCAGAGAGCAAGAAGG - Intronic
1185989960 X:4882663-4882685 CTTCATCTCTGAAAGCAAGAAGG - Intergenic
1186520975 X:10206613-10206635 CTGCAAGTCAGACAGCAGGAGGG - Intronic
1187766172 X:22644762-22644784 TGGCATCTCAGGAAGAAGGAGGG + Intergenic
1188054115 X:25521982-25522004 CTGCATATCAGAAATCACCAGGG - Intergenic
1188131111 X:26433838-26433860 CTGCAGCTCAGCAAACGGGAGGG + Intergenic
1188368574 X:29340714-29340736 CTGTATTTCAGAAAGGAAGAAGG - Intronic
1188868008 X:35338469-35338491 GTGCATCTCAGAGAGAGGGATGG + Intergenic
1189273371 X:39767411-39767433 CTGCATGCCTGAAAGAAGGAGGG - Intergenic
1189658360 X:43270691-43270713 TTGCATTTCAGGTAGCAGGAAGG + Intergenic
1190803671 X:53814717-53814739 CTGCAACTCAGACAGGAGGCAGG - Intergenic
1192368216 X:70492740-70492762 CTGCTTTTCAGAAAGCAGAGAGG + Intronic
1192529903 X:71874984-71875006 CTGCAGGTCAGAAACCAGGCAGG + Intergenic
1194019507 X:88669317-88669339 CTACATCTCAGAAAGCCCTAGGG - Intergenic
1194466038 X:94236470-94236492 CTCCATGTCAGAAAGAAAGAAGG - Intergenic
1195509508 X:105697992-105698014 CTGAATCTCAGGAAGCAGGAGGG - Intronic
1196039238 X:111184033-111184055 CTGAAGCCCAGAAAGCAGGAAGG - Intronic
1197529218 X:127602057-127602079 TTGTATCTCAGAAAATAGGAAGG - Intergenic
1198202114 X:134432113-134432135 TTACTTTTCAGAAAGCAGGAAGG - Intergenic
1199916840 X:152351873-152351895 CTGTATCTCAGGGAGAAGGAAGG + Intronic
1201686654 Y:16712193-16712215 CTCCACCTCTGAAAGCAAGATGG + Intergenic