ID: 1026426320

View in Genome Browser
Species Human (GRCh38)
Location 7:70297957-70297979
Sequence GCTCTAAGAAAGCTGAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026426320_1026426328 27 Left 1026426320 7:70297957-70297979 CCTTTGCTCAGCTTTCTTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1026426328 7:70298007-70298029 CTCTTTTTTTGGTTTTTTTTGGG 0: 1
1: 2
2: 222
3: 3329
4: 23622
1026426320_1026426323 16 Left 1026426320 7:70297957-70297979 CCTTTGCTCAGCTTTCTTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1026426323 7:70297996-70298018 AAACCCAAAGCCTCTTTTTTTGG No data
1026426320_1026426327 26 Left 1026426320 7:70297957-70297979 CCTTTGCTCAGCTTTCTTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1026426327 7:70298006-70298028 CCTCTTTTTTTGGTTTTTTTTGG 0: 1
1: 1
2: 64
3: 957
4: 7586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026426320 Original CRISPR GCTCTAAGAAAGCTGAGCAA AGG (reversed) Intronic
905844359 1:41215650-41215672 GAGCTAGGAAAGCTGAGAAAGGG - Intronic
906471720 1:46136503-46136525 GTGCTAAGAAAGATGAGGAAAGG - Intronic
909415341 1:75400175-75400197 ACTCTAAGAAAGGAGAGGAAAGG + Intronic
914216191 1:145631495-145631517 GCTATAAGAAATGAGAGCAAAGG + Intronic
914468762 1:147954153-147954175 GCTATAAGAAATGAGAGCAAAGG + Intronic
915024145 1:152811510-152811532 GCCTCAAGAAAACTGAGCAAAGG + Intronic
915172044 1:153985132-153985154 GCTCTAAGAAAACAGAGAAGAGG - Intronic
916291111 1:163167288-163167310 GCTCTAAGATAGCAGAGCGAAGG + Intronic
917495667 1:175538027-175538049 TATTTAAGAAACCTGAGCAAGGG + Intronic
919971872 1:202585908-202585930 ATTTTAAGAAAGCTGAGGAAAGG - Exonic
920296064 1:204957634-204957656 GCTATAAGAAAGCAGAGGTACGG - Exonic
921258959 1:213368575-213368597 GCTCTAACAATGCACAGCAAGGG - Intergenic
922317960 1:224459002-224459024 GCCCTAAGAGAGCTGATCACTGG - Intronic
924137770 1:240988737-240988759 GATCTAAGAAATCTCAGCAATGG + Intronic
924686257 1:246293869-246293891 GCTCTAGCAAAGCTCACCAAAGG + Intronic
1062831578 10:608811-608833 CCTCTAAGAAGACTAAGCAATGG - Intronic
1064850377 10:19702954-19702976 GCTCAGAGAAAGCTAAGCACAGG + Intronic
1064994519 10:21284744-21284766 GCTTTGAGGAAGCTGTGCAAGGG - Intergenic
1066461240 10:35614183-35614205 GATCTAAGAATTCTCAGCAATGG + Intergenic
1067101389 10:43337178-43337200 CCTCTCAGAAAACTGAGCTATGG + Intergenic
1069743772 10:70702100-70702122 GTGGTAGGAAAGCTGAGCAAAGG - Intronic
1070779197 10:79127675-79127697 GGTCTAAAAAGGCTGAGCAGGGG - Intronic
1070989426 10:80718468-80718490 GTTCCAAGCAAGCTGAGAAAGGG - Intergenic
1072239544 10:93482715-93482737 GCTTTAAAAAAGCTGAACATAGG - Intergenic
1073320456 10:102613304-102613326 GCTTTAGGAAAGCAGAGGAAGGG + Intronic
1073928198 10:108542148-108542170 GATTTAACAGAGCTGAGCAATGG + Intergenic
1074494273 10:113965304-113965326 GGTCAAAGAAGGCTGAGCAGAGG + Intergenic
1074600533 10:114908945-114908967 CCTCTAAGGAAGCTCGGCAAGGG - Intergenic
1077244470 11:1529530-1529552 GCACCATGAAAGCTCAGCAATGG + Intergenic
1077465861 11:2733393-2733415 TCTGGAAGGAAGCTGAGCAAAGG - Intronic
1077892066 11:6426003-6426025 ACTCAAAGAAAGCAAAGCAAGGG + Intergenic
1085760329 11:79235811-79235833 GCTCAAAGAAAGGAGGGCAAGGG - Intronic
1086041400 11:82483662-82483684 ACTTTCAGAAAGCAGAGCAAAGG + Intergenic
1088824559 11:113482894-113482916 GCTCGAAGAAGGCAGAGAAAGGG - Intergenic
1091603777 12:1933866-1933888 TCTCTAAGCAGGCTCAGCAAAGG + Intergenic
1096552733 12:52384050-52384072 TCTCTAAGAAAGCTGTACACTGG + Intronic
1096658654 12:53107427-53107449 GCTTTAAGAAAGCAGAGCTTAGG + Intronic
1100607580 12:96164194-96164216 GCTCTAAGGCAGCTGTGAAAGGG + Intergenic
1101715465 12:107308399-107308421 GCTTTAAAGAAGCAGAGCAAAGG + Intergenic
1103050766 12:117777667-117777689 GCTCTAAGAAGGCAGAGCCCTGG + Intronic
1103859280 12:123999095-123999117 TCTCTAAGAAAGATAATCAAAGG - Intronic
1105840299 13:24248225-24248247 GCTCTGAAAAAGCTGGGCCATGG - Intronic
1107089813 13:36466190-36466212 GCTATGAGAATGCAGAGCAAGGG - Intergenic
1107561788 13:41563473-41563495 GCTGTAAGAAATCTCACCAAGGG - Intergenic
1112737563 13:102438367-102438389 CCCCTCAGAGAGCTGAGCAAAGG - Intergenic
1113600007 13:111561846-111561868 GCTCTGTGAAGGCTGAGCTAGGG - Intergenic
1117020391 14:51564528-51564550 GGTCTGAGAGAGCTGACCAAGGG + Intronic
1117732146 14:58733875-58733897 GATCTAAGAAAGCAGCTCAAAGG - Intergenic
1117928369 14:60810367-60810389 GCTCAAAGTAAGCAGAACAAAGG - Intronic
1118412837 14:65500750-65500772 GCTGTAACAAAACTGAACAATGG + Intronic
1121589266 14:95088911-95088933 AGTTTAAGAAAGCTGAGCAGAGG - Exonic
1121608765 14:95261212-95261234 GCACTAAGTAAGCTGTGGAAAGG + Intronic
1122837701 14:104438141-104438163 CCTCTAAGAAAGCAAAGCAAAGG + Intergenic
1124638344 15:31379319-31379341 GCTCTGAGAAGGCGGAGCAGTGG - Intronic
1124665307 15:31587049-31587071 GCTCTTAGATAGCCGAGCAGAGG - Intronic
1125933146 15:43614169-43614191 GCACTGAGAAAGGGGAGCAAGGG - Intronic
1125946244 15:43713631-43713653 GCACTGAGAAAGGGGAGCAAGGG - Intergenic
1127053090 15:55105260-55105282 CTTTTAAGAAAGCTGAGCACTGG - Intergenic
1129003605 15:72354135-72354157 GAGCTAAGAGAGCTGAGAAAAGG + Intronic
1130112139 15:80974185-80974207 GCTATAGGAAAGCTGAGAGAAGG + Intronic
1131111149 15:89766106-89766128 CCTCCAAGAAGGCTGAGCCAGGG - Intronic
1131123324 15:89836998-89837020 GCTCTGGGAAGGCTGAGGAAGGG + Intronic
1131953731 15:97709267-97709289 GCTCTAAGGAAGGAGTGCAATGG + Intergenic
1132058281 15:98669232-98669254 GCTCTCTGAAACCTGCGCAAGGG + Intronic
1134262081 16:12659497-12659519 GCTCAAAGAATACTCAGCAATGG - Intergenic
1135004192 16:18803410-18803432 CCCCTAAGAGAGCTGGGCAAGGG + Intergenic
1135269413 16:21056141-21056163 GGTCTATAATAGCTGAGCAATGG - Intronic
1140731757 16:77862926-77862948 GCTCTTTGAGAGCAGAGCAAGGG - Intronic
1141013560 16:80426274-80426296 GTCCTAAGAAAGCTTAGAAAGGG - Intergenic
1142550186 17:733257-733279 GCGCTCAGAAAGCTGACTAATGG + Intronic
1148077918 17:44949943-44949965 GCTCAAAGGAAGCAGAGGAAAGG + Intergenic
1148825542 17:50390824-50390846 GCTCTAGGACAGCTGTGCTAGGG + Intronic
1149969985 17:61207791-61207813 ACTCTAAGAAAACTGAAAAATGG - Intronic
1150898308 17:69239410-69239432 GCTCTAAGAAATCAGATCAGGGG + Intronic
1152326146 17:79638937-79638959 GCTATAAAATAGCTGAGCATGGG - Intergenic
1152371511 17:79891353-79891375 GCTCTAAGCAAGAGGAGCTATGG + Intergenic
1152378227 17:79929528-79929550 TCTCTATAAAACCTGAGCAAAGG - Intergenic
1156568918 18:38229026-38229048 TCTATAAGAAAGCTAGGCAATGG + Intergenic
1159163593 18:64674741-64674763 GCTATAAAAACGCTGAACAAAGG - Intergenic
1162960746 19:14124747-14124769 GCACTAAGTAGGCTGAGGAAAGG - Intronic
1167995886 19:53401936-53401958 GTTCTAACAAATCTGAGTAAGGG - Intronic
1168001428 19:53449385-53449407 GTTCTAACAAATCTGAGTAAGGG - Intronic
1168414157 19:56158450-56158472 GAACTCAGAAACCTGAGCAAGGG - Intronic
926318507 2:11730281-11730303 GTCCTAACAAAGGTGAGCAACGG - Intronic
930319549 2:49836886-49836908 GGTTTAAGACAGCTGAGCACTGG - Intergenic
931424608 2:62159243-62159265 GCCCTATGAAGGCTGAGCAGGGG - Intergenic
932294907 2:70616218-70616240 GCCCTTAGTGAGCTGAGCAAGGG - Intronic
935363750 2:102268731-102268753 GCGATGAGAAGGCTGAGCAAGGG - Intergenic
939514509 2:143149706-143149728 ACTCTAAGAAATATTAGCAAAGG + Intronic
939969416 2:148643861-148643883 ACTCGAAGAAATCTGAGAAAAGG - Intergenic
940653144 2:156457300-156457322 CCTGTAAGAAGCCTGAGCAAAGG - Intronic
943536556 2:189159098-189159120 CCTCAAAGAAACCTGAACAAAGG + Intronic
944940407 2:204619278-204619300 GCTCTCTGAAAGCTGAGGGATGG + Intronic
946278831 2:218651404-218651426 GCTCTCAGAAAGTTGTGAAATGG + Intronic
948338803 2:237232664-237232686 GCACTAAGAAAGATGGGCCAAGG + Intergenic
1171290683 20:23981390-23981412 GCTCTAGGAAAGCAGAGCTGGGG + Intergenic
1171480680 20:25453748-25453770 GCTCTTAGAAATCTGACCCAAGG + Intronic
1172297163 20:33821038-33821060 GAACTAAGAAACCTGAGCAGTGG + Intronic
1174238854 20:49116719-49116741 GTTATAAGAAAACTGAGAAAAGG - Intronic
1175876301 20:62231849-62231871 GCTCAGAGAAGGCAGAGCAAGGG - Intergenic
1176945485 21:14975450-14975472 GCTCTAAGAAAACTGAAGATGGG + Intronic
1177245772 21:18521105-18521127 ACAGTAAGAAAGCTGATCAATGG - Intergenic
1177330558 21:19655009-19655031 GCTCTCAGGAAGCTGAGGCAGGG + Intergenic
1181401292 22:22651530-22651552 GCTCTAGGAAAGCGGAGCTGGGG - Intergenic
1181703261 22:24632612-24632634 GCTCTAGGAAAGCAGAGCTGGGG - Intergenic
1182402732 22:30093957-30093979 GCAGTGAGAAAGCTGAGCAGTGG - Exonic
1183253418 22:36745718-36745740 GCCCAAAGAAAGGTGAGTAATGG - Intergenic
950833309 3:15896497-15896519 GCTATAAGAATGCTGAGGTAGGG + Intergenic
951496228 3:23330102-23330124 ATTCTAGGAAAGCTGAGGAAAGG - Intronic
953967241 3:47318764-47318786 ACTCTAAGAAATTTGAGCAGAGG + Intronic
955332746 3:58060996-58061018 CCACTGAGAAAGCTGAGCCAAGG + Intronic
959512139 3:107225698-107225720 GCTGTAAGAAGCCTGAGCCATGG - Intergenic
959519620 3:107310426-107310448 GCACTAAGAAAACTGACAAACGG - Intergenic
960540491 3:118856249-118856271 GCTCTAAGAAATATCAGCAAGGG + Intergenic
960833843 3:121882891-121882913 GGTCTCATAAAGCTGAGCAATGG - Intronic
962163845 3:133028208-133028230 GCTCTAAGTAAAATTAGCAAGGG + Intergenic
962831821 3:139148848-139148870 ACCCATAGAAAGCTGAGCAAAGG + Intronic
966134729 3:176685422-176685444 GCTCAAAGAATGACGAGCAAAGG + Intergenic
967328613 3:188267645-188267667 GCTGAAAGAATGCTGAGCACAGG - Intronic
967916090 3:194579381-194579403 GGACTAAGAAAGCTGGACAATGG - Intergenic
968199607 3:196740495-196740517 GCATTAAGAAAACGGAGCAAAGG - Intronic
968263391 3:197343247-197343269 GCTCTAGGACACCTGAGGAAGGG - Intergenic
970648896 4:18156252-18156274 GCTATAAGAGAGGTGAGAAAAGG - Intergenic
973105874 4:46336349-46336371 GAAGTAACAAAGCTGAGCAAAGG + Intronic
975895883 4:79089611-79089633 GCTCTGAAAAAGCTGACCAAGGG + Intergenic
977810140 4:101347766-101347788 GCTGGAAGAAAACAGAGCAAGGG - Exonic
980371053 4:131872047-131872069 GGTCTAATAAAACTGAGCAGTGG - Intergenic
983534981 4:168848049-168848071 CCTCTAAGAAAACTGAGCCCAGG + Intronic
984125137 4:175799190-175799212 TCCCTAAGACAGATGAGCAAAGG - Intronic
991203096 5:64017064-64017086 GAGATAAGAAAGCAGAGCAAGGG + Intergenic
992125696 5:73637855-73637877 GCTCTCAGCAGCCTGAGCAAAGG + Intronic
992251065 5:74876414-74876436 GCTCTAAGAGACTTGATCAAAGG - Intergenic
992624164 5:78621980-78622002 TCTCTAAGAAATCTGACCACAGG + Intronic
992847413 5:80765062-80765084 GCTACAAGAAAGCTGAGGATGGG - Intronic
993276960 5:85872337-85872359 GTTCTAATAAAGGAGAGCAAAGG - Intergenic
993982475 5:94559177-94559199 GCTTGAAGAAAGCTCAGTAAAGG - Intronic
996109681 5:119550660-119550682 ACCCAAAGAAAGCGGAGCAAAGG + Intronic
996912601 5:128672126-128672148 CCTCAAAGAAGGCTGAGAAATGG + Intronic
997413762 5:133709539-133709561 GCTCTTGGCATGCTGAGCAATGG + Intergenic
999241882 5:150132645-150132667 GCTCTCAGAAAGCTGGGCCTAGG + Intronic
1001164809 5:169354545-169354567 ACCCTGAGAAACCTGAGCAAAGG + Intergenic
1001446311 5:171786561-171786583 GCTATGAGAACCCTGAGCAAGGG + Intronic
1001741388 5:174055688-174055710 CCTCTGAGAAAGCAAAGCAAAGG + Intronic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1003123027 6:3333591-3333613 GCTCTTAGAGACCTGAGAAAAGG - Intronic
1003400336 6:5785358-5785380 GCTGGAAGGAAGCTTAGCAACGG + Intergenic
1003674189 6:8188122-8188144 GCTCTAAGAAAGCTCTGCACAGG - Intergenic
1004128239 6:12894727-12894749 GCTATAAGACATCTGAGAAATGG + Intronic
1005279199 6:24253148-24253170 ACTCAAAGAAAGCTGAAGAAAGG + Intronic
1006575894 6:35045575-35045597 ACTCTATGAAAGCTCAGCATAGG - Intronic
1007025918 6:38573869-38573891 CATCTAAGAAAGCTGTGGAAAGG + Intronic
1007462882 6:42030851-42030873 GCTCTAAGGGAGCTGAGCCAAGG + Intronic
1007806988 6:44457834-44457856 TCTCTTAGAAAGCAGAGGAATGG + Intergenic
1008376616 6:50798835-50798857 GCTCTAGGAAGGCTGTTCAAAGG - Intergenic
1008458026 6:51734581-51734603 GCTGTAATGGAGCTGAGCAACGG + Intronic
1014734091 6:125071284-125071306 GCTCAAAGTAAGCTGGGCAGTGG + Intronic
1015575816 6:134669897-134669919 GCTATAAGAAATCTGATAAATGG - Intergenic
1015664640 6:135615351-135615373 GGTCTAGGACAGCTGAGCAAGGG - Intergenic
1020610582 7:10391788-10391810 GCCCTAAGGAAGCTGAGACATGG - Intergenic
1026250621 7:68667048-68667070 AGTCTTAGAAAGCTGAACAAGGG - Intergenic
1026426320 7:70297957-70297979 GCTCTAAGAAAGCTGAGCAAAGG - Intronic
1029043380 7:97600903-97600925 CCTCTAGGCAAGGTGAGCAAGGG + Intergenic
1030968814 7:116027647-116027669 CATCTAAGGAAGCTGAGCATTGG + Intronic
1031011757 7:116531906-116531928 GTTCTCAGAATACTGAGCAAAGG + Intronic
1031019946 7:116616499-116616521 GCTCTAAGAAAATTTAGCAGAGG - Intergenic
1031763338 7:125742260-125742282 GCACTTTGAAAGCTGATCAAAGG - Intergenic
1032411494 7:131696527-131696549 GCTCTATGATAGCTGAGCCTGGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1035596493 8:862244-862266 GCTCCAAGACACCTGAGAAAAGG - Intergenic
1037189284 8:16101702-16101724 ACAATAAGAAAGCTGAGGAAAGG + Intergenic
1038772848 8:30499929-30499951 CATCTAAGAAATCTGTGCAAAGG + Intronic
1040400808 8:47047482-47047504 TCTTTAAGAAAGCTGAACATTGG - Intergenic
1041334501 8:56765359-56765381 GCTCTTAGACAACAGAGCAACGG - Intergenic
1047886107 8:129251670-129251692 GCACTAAGAAAGCAGAGTTAAGG - Intergenic
1048852894 8:138661536-138661558 GCTCAGAGATGGCTGAGCAAAGG + Intronic
1049195443 8:141313212-141313234 TCTCTAAGGAAGCTGGGCAGGGG - Intergenic
1052787417 9:32842476-32842498 GCTCTCAGAAATCTGAGCCAGGG + Intergenic
1054967945 9:71051154-71051176 GTTCAAAGAAAGCTCTGCAATGG - Intronic
1055431970 9:76253095-76253117 GCTTTATGAATGCTGAGCAGCGG - Intronic
1062489191 9:136796329-136796351 GCTCTGAGCAAGCTGAGCCCAGG + Intronic
1062535829 9:137020734-137020756 GCTGTACGAAGGCTGAGCACTGG + Exonic
1062682742 9:137791016-137791038 TTTCTCAGAAAGCTGAGCAAGGG + Intronic
1186107525 X:6223551-6223573 GCTCCAAGAAAAATGAGGAAGGG + Intronic
1189697766 X:43682929-43682951 GCTCAAACAAAGCTGAGAACAGG - Intronic
1192490085 X:71569006-71569028 GCTCTAAAAACTCTGAGGAAGGG - Intronic
1193511235 X:82402268-82402290 GCTTAAAGAAACCTGAGAAAAGG + Intergenic
1196223290 X:113137113-113137135 GATCATAGAAAACTGAGCAATGG - Intergenic
1196674734 X:118407560-118407582 TCACTAAGAAAGCTATGCAAAGG + Intronic
1197481386 X:126991022-126991044 GCTCTAAGAAAGCATAGCTTAGG - Intergenic
1199527243 X:148806259-148806281 ACTGGAAGAAAGCTGAGCTAAGG - Intronic