ID: 1026427517

View in Genome Browser
Species Human (GRCh38)
Location 7:70311364-70311386
Sequence TGGGAGACAAGAATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 741}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026427517 Original CRISPR TGGGAGACAAGAATGGAGAA AGG (reversed) Intronic
902725142 1:18330533-18330555 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725158 1:18330581-18330603 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725174 1:18330629-18330651 TGGGAGACATGGCTGGAGGAAGG + Intronic
902732900 1:18381431-18381453 TGGGAGACTGGACTGGAGATTGG - Intergenic
902803062 1:18842396-18842418 TGGGAGACAAAAAAGGACACTGG + Intronic
902844433 1:19098699-19098721 TGGGAGAAAAGAAAGGAGAGAGG + Intronic
904166682 1:28560983-28561005 TGGGAGGCAGCAATGCAGAATGG - Intronic
904357846 1:29952772-29952794 TAAAAGACAAGAATGGTGAAGGG + Intergenic
904484309 1:30814742-30814764 TGGGAAACAAGAAGGCAGAAAGG - Intergenic
904883179 1:33715716-33715738 TACGGGACAAGAATGGTGAAGGG + Intronic
904989074 1:34576710-34576732 GAAGAGGCAAGAATGGAGAAAGG - Intergenic
905479142 1:38249215-38249237 TGTGAGAGGAGAGTGGAGAATGG - Intergenic
905556214 1:38886686-38886708 TGGGAGAAAAGGAGGGAAAATGG + Intronic
906461522 1:46038093-46038115 AGGGGGACAAGAATGGAAGAAGG + Intergenic
906683196 1:47744879-47744901 TTGGAGACAAGCCTGGGGAAGGG + Intergenic
906742923 1:48199856-48199878 TGTGAGAAAAGATTGGAGAAGGG + Intergenic
906764837 1:48419404-48419426 AGGGAGACAAGGATGAAGACAGG + Intronic
906884508 1:49629897-49629919 AAAGAGGCAAGAATGGAGAATGG - Intronic
907114426 1:51956535-51956557 GAGGAGAAAAGAATGGAGAGGGG - Intronic
907396545 1:54194485-54194507 TGAGCCACAAGAATGGGGAATGG + Intronic
907445841 1:54507143-54507165 ATGGAGACAAGACTGGAGGAAGG + Intergenic
907819492 1:57953252-57953274 TGGGAGGCAAGAATGTATACGGG + Intronic
907951747 1:59189896-59189918 AGGGAAAGAAGAATGGAGAGGGG - Intergenic
908496521 1:64700088-64700110 GAGGAAACAAGAATGGAGAGAGG - Intergenic
908609170 1:65836858-65836880 TAGGAAGGAAGAATGGAGAATGG - Intronic
909471645 1:76035610-76035632 CGGGAGAGAATAATGGAGAGTGG - Intergenic
910014440 1:82504078-82504100 TGGGAGAAATGCATTGAGAAAGG - Intergenic
910066205 1:83154316-83154338 TGAGAGAGAAGAATTAAGAACGG - Intergenic
910241182 1:85087681-85087703 GGGGAAAAAAGAATGGAGGAGGG + Intronic
910873904 1:91859542-91859564 TGATAGACAAAAATAGAGAATGG + Intronic
910985543 1:93001749-93001771 TGGGAAACAAAAATGGAAGAAGG - Intergenic
911491200 1:98568343-98568365 GGGGAGACAAGTAAGGAGACAGG - Intergenic
911507450 1:98771004-98771026 GGGGAAAGAGGAATGGAGAAAGG - Intergenic
911537936 1:99122963-99122985 TGGGAAACAAGAATGAGGAAAGG + Intergenic
911553539 1:99314430-99314452 TGAGAGAAAAGAATGGATTAAGG - Intergenic
911724090 1:101223512-101223534 TGAGAGACAAGAATGCAGAGTGG + Intergenic
912025957 1:105172682-105172704 TTGGAGAGCAGAGTGGAGAATGG - Intergenic
912924338 1:113900693-113900715 TGGGGGACATGACTAGAGAAGGG + Intronic
913063452 1:115228511-115228533 AGGAAGAAAAGAACGGAGAAAGG - Intergenic
913616744 1:120567625-120567647 TGGGAGACAGTAATGTTGAACGG + Intergenic
913676634 1:121146959-121146981 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
914028530 1:143934909-143934931 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
914573531 1:148943285-148943307 TGGGAGACAGTAATGTTGAACGG - Intronic
914831661 1:151174928-151174950 TGGGACAAAAGGATGGACAATGG + Intronic
915317447 1:155037116-155037138 TGGCACACAAGCATGGAGACTGG - Intronic
915721453 1:157988747-157988769 TGAGATACAAAAGTGGAGAAGGG + Intergenic
915911698 1:159919494-159919516 TTGGAGGCTGGAATGGAGAAGGG - Intronic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916275953 1:162993418-162993440 TGGGGTATAAGAAAGGAGAAAGG + Intergenic
916986745 1:170199938-170199960 TGAGAGACAGGAAGGAAGAAAGG + Intergenic
916997428 1:170315794-170315816 TTGGAGACAATGATGAAGAAAGG - Intergenic
917053904 1:170957437-170957459 AGGGAGACAAGAATTCACAATGG - Intronic
917164412 1:172096369-172096391 GGTGAGACAAGACTGGAAAAAGG + Intronic
917223171 1:172753524-172753546 TGAGAGAAAAGAAGGAAGAAAGG - Intergenic
917910109 1:179635041-179635063 TGGGAGACAAGAACACAAAAAGG - Intronic
918164738 1:181934378-181934400 TGGGAAAGAAGGATGGAGAAGGG + Intergenic
918643774 1:186877535-186877557 TGAGAGAACAAAATGGAGAATGG + Intronic
918726526 1:187932856-187932878 TGAATGACAAGAATGGATAAGGG + Intergenic
918740642 1:188127091-188127113 TGGGAGATAGTAATGGAGACTGG - Intergenic
919183424 1:194114778-194114800 TGGGACTGGAGAATGGAGAAAGG + Intergenic
919521332 1:198591918-198591940 GGGGAGACTAGAATGGTAAATGG - Intergenic
919544193 1:198893293-198893315 TGGGAGACATGAAATAAGAATGG - Intergenic
919594820 1:199548190-199548212 TGGGAGGAAAGAAAGGAGGATGG - Intergenic
919627838 1:199929602-199929624 TGGGTAACATGGATGGAGAAAGG - Intergenic
919662048 1:200256855-200256877 GGGGAGGGGAGAATGGAGAATGG + Intergenic
919827527 1:201514037-201514059 CGAGAGATATGAATGGAGAATGG + Intergenic
920100283 1:203513108-203513130 TGGGGAACAGAAATGGAGAAAGG + Intergenic
920279125 1:204829687-204829709 TGGGAAACTAGGATGGGGAAGGG + Intronic
920363950 1:205438346-205438368 TGGGAGAGAACCATGGAGAGAGG + Intronic
920463997 1:206165800-206165822 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
920569104 1:207002871-207002893 TGTGAGACAAGAATGTGGAGAGG + Intergenic
921285925 1:213609355-213609377 TAGGAGACCAGAAGTGAGAAAGG - Intergenic
921954267 1:220965869-220965891 TGGTACAGAAGAAGGGAGAATGG + Intergenic
922022098 1:221715926-221715948 AGGGAGAGAAGAGTGGAGAAGGG - Intronic
922314497 1:224430996-224431018 TGGAATGCAAGAATGGAAAATGG + Intronic
922560543 1:226566033-226566055 TGGGGGACAAAAATGCAAAACGG - Intronic
922570315 1:226630866-226630888 AAGGAAACAAGAAAGGAGAAAGG + Intergenic
922626508 1:227050818-227050840 TGGGAAAGAAGAGTGGGGAACGG + Intronic
922746689 1:228048228-228048250 TGGGAGAGCAGGAGGGAGAAGGG - Intronic
922987722 1:229878999-229879021 TGTGAGGGAAGAAGGGAGAATGG + Intergenic
923288277 1:232518570-232518592 TGGGACACAAGCCTGGAGAGTGG - Intronic
923656637 1:235922580-235922602 TGGAAAACAAGAATGGCCAAGGG + Intergenic
924197469 1:241623389-241623411 GGAGAGGCAAGAATGGAGAAGGG - Intronic
924440620 1:244082521-244082543 TTGGAGAAAAGATTGGAGAGAGG + Intergenic
924703796 1:246481405-246481427 TAGAACAAAAGAATGGAGAAAGG + Intronic
924827226 1:247552349-247552371 TGTGAGAGAAGGCTGGAGAATGG + Intronic
1063396785 10:5695734-5695756 TGGGAAACTAGAAAGGAGATGGG + Intronic
1063473491 10:6307957-6307979 TGAGAGAAAGGAATGGGGAAGGG - Intergenic
1063502341 10:6566613-6566635 TAGGAGAAAAGACTGGAGAGAGG - Intronic
1064266246 10:13827817-13827839 TGGGAGAGGAGGAGGGAGAAGGG + Intronic
1064364183 10:14692206-14692228 TGGGTGGAAAGAAAGGAGAAGGG + Intronic
1064669869 10:17701735-17701757 TTGGAGAGAAGAATTGAAAAGGG - Intronic
1064756120 10:18573040-18573062 ATGGAGAAGAGAATGGAGAATGG - Intronic
1064756197 10:18573522-18573544 TGGGAGAAGGGAATGGAGAATGG - Intronic
1064915888 10:20457926-20457948 TGGGAGAGTAGATTGGAAAAAGG - Intergenic
1064984296 10:21194636-21194658 GTGGAGCCAAGAATAGAGAAAGG + Intergenic
1065937278 10:30531869-30531891 TGGGAGGCAAGAAGGCAGTAGGG + Intergenic
1066376808 10:34864904-34864926 TAGGAGATCAGAATAGAGAAAGG + Intergenic
1067083213 10:43223861-43223883 AGGGAGAGAAGAAGGAAGAAAGG + Intronic
1067760973 10:49046799-49046821 TGGGAACTAAGTATGGAGAAAGG + Intronic
1067832830 10:49620289-49620311 TGGGACAGAAGAAAGGAGACAGG + Intronic
1067834761 10:49631802-49631824 TGGGAGAGGAGGATGGAGACTGG + Intronic
1067976862 10:51036417-51036439 TGGGATATGAGCATGGAGAAGGG + Intronic
1068574723 10:58672275-58672297 TGAGAGAGAAGAAAGTAGAATGG - Intronic
1068962816 10:62882665-62882687 TGGCAGGGGAGAATGGAGAAGGG - Intronic
1069726939 10:70586206-70586228 TGGGAGAGAAGCAGTGAGAAGGG + Intergenic
1069755426 10:70771857-70771879 TGGGGGACAAGAATGGGTGAGGG - Intronic
1070284833 10:75075373-75075395 AGGGTGACAAGGATAGAGAAGGG + Intergenic
1070380454 10:75876355-75876377 AGGGAGAAAAGGCTGGAGAAGGG + Intronic
1070675028 10:78406441-78406463 AGGGAGAAAAGAAAGGAGCAAGG - Intergenic
1072828666 10:98634820-98634842 TGGTAGACATGTATGGATAAAGG - Intronic
1073140679 10:101245378-101245400 TGGGAAATAAGGAAGGAGAAGGG + Intergenic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1074478653 10:113797232-113797254 TGTCAGACAAAAAAGGAGAAAGG - Intergenic
1074817076 10:117150484-117150506 TGGGAGACAAGGCAGCAGAATGG + Intergenic
1074947587 10:118296360-118296382 TGGGAGACAGGTGTGTAGAAAGG + Intergenic
1074989219 10:118687679-118687701 TGGGAGAGTAGGCTGGAGAATGG - Intronic
1075512508 10:123083913-123083935 TGGGAGACAGGAGTGGAGCAGGG - Intergenic
1075590784 10:123689823-123689845 ATGGAGACTAGAATGGAGACAGG + Exonic
1075904767 10:126071589-126071611 TTGGAGACCAGCCTGGAGAAAGG - Exonic
1075957699 10:126538131-126538153 TGGAAGGCAAAAAAGGAGAAAGG + Intronic
1076247478 10:128958638-128958660 TGGAAGACAGGAATGTAAAATGG - Intergenic
1076564465 10:131388736-131388758 TGGGAGGCAAGAATGGGGTGGGG - Intergenic
1076608788 10:131707409-131707431 TGGCAGACAGGAATGCAGAGAGG + Intergenic
1077344946 11:2042623-2042645 GGAGAAAGAAGAATGGAGAAAGG - Intergenic
1077345859 11:2052646-2052668 GGAGAGTGAAGAATGGAGAATGG - Intergenic
1077345981 11:2054118-2054140 GGAGAAAAAAGAATGGAGAAGGG - Intergenic
1077346369 11:2058196-2058218 GGGGAATGAAGAATGGAGAATGG - Intergenic
1077346663 11:2061504-2061526 TGGGATATAAAAATGGAGTATGG - Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079369434 11:19838049-19838071 AGGGAGAAAGGAAAGGAGAATGG + Intronic
1079436436 11:20457252-20457274 TGGAAGAGAAGGAAGGAGAAAGG - Intronic
1079916828 11:26379479-26379501 TTGGAAATAAGAATGGTGAAAGG + Intronic
1079979262 11:27131986-27132008 TGGGTCACAAGACTGGAGATGGG - Intergenic
1080041068 11:27759892-27759914 TGGGAGATGTGATTGGAGAAGGG + Intergenic
1080145819 11:28982354-28982376 AGGGAGAGAGGAAGGGAGAAAGG + Intergenic
1080719751 11:34837559-34837581 TGGGAGAAGAGGCTGGAGAATGG - Intergenic
1080918989 11:36689734-36689756 TAGGAGACAGGAAGGGAGAAAGG - Intergenic
1081354812 11:42099586-42099608 GGAGAGACCAGGATGGAGAAAGG + Intergenic
1081398944 11:42620287-42620309 AGGTAGAAAAGAAAGGAGAAAGG + Intergenic
1081951734 11:47049920-47049942 AGGGAAAGAAGAATGGATAATGG + Intronic
1082189957 11:49231169-49231191 TGGAAGGCAGGAATGAAGAAAGG + Intergenic
1082244511 11:49905664-49905686 TGGGAGATAAGGATGGTTAATGG - Intergenic
1082564222 11:54656699-54656721 TGAGAGAAAAGGATGGAAAAGGG - Intergenic
1082811156 11:57479812-57479834 TGGCAGACGAAAATGCAGAATGG - Intergenic
1083991483 11:66248672-66248694 TGGGAGTCTGAAATGGAGAAAGG - Intergenic
1084173867 11:67413385-67413407 TGCGAGACAGGCAGGGAGAAGGG + Intronic
1085280695 11:75328540-75328562 TGGGAGACAAGGATGTAAGAAGG - Intronic
1085692604 11:78676098-78676120 TGGGGGGAAAGAATGGGGAACGG - Intronic
1086120996 11:83304298-83304320 GAGGAGAGGAGAATGGAGAATGG + Intergenic
1086515621 11:87609682-87609704 AGGGTGACAAGAATGCACAATGG + Intergenic
1086676571 11:89615373-89615395 TGGAAGGCAGGAATGAAGAAAGG - Intergenic
1086777246 11:90853769-90853791 AGGGAGAAAAGAAGGGAGAAAGG + Intergenic
1086916353 11:92534089-92534111 TGGCATCCAAGAATGGAGAGAGG - Intronic
1087135043 11:94707945-94707967 TGGGAGGTAAGACTGGAGAGAGG - Intronic
1087491451 11:98832452-98832474 TGCAAGACAAGGAAGGAGAATGG + Intergenic
1087550601 11:99642735-99642757 GGGGAGAAGAGGATGGAGAAAGG - Intronic
1087845840 11:102971557-102971579 AGGGAGAGAGGAATGGAGGAAGG + Intergenic
1088732527 11:112695839-112695861 TGGGACACATGAATGGTGAGTGG + Intergenic
1089013942 11:115151712-115151734 TGGGAGAAAGGGAGGGAGAAGGG - Intergenic
1089158837 11:116422713-116422735 TGGAAGACAAGACTGTAGACAGG - Intergenic
1089385160 11:118062516-118062538 TGGGAGTCAACAATGGAGACAGG + Intergenic
1089690410 11:120183599-120183621 TGGGTGGCAAGACTGGGGAAAGG + Intronic
1089883830 11:121800528-121800550 TGGGAGACAGGAAAGGAGGAAGG + Intergenic
1089903143 11:122009792-122009814 TGGGAAACTGGAATGGAGAACGG + Intergenic
1089934363 11:122348438-122348460 TTGGAACCTAGAATGGAGAATGG - Intergenic
1090082196 11:123621338-123621360 TGGGAGACTAGAATGGAACCTGG - Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090653386 11:128825124-128825146 AGGGAGAAAAGAATGGAAGAAGG - Intergenic
1090765387 11:129871742-129871764 TGGGGGACAAGAACGGAAATGGG - Intronic
1090961987 11:131565291-131565313 AGAGAGACAAGCATGGATAAGGG - Intronic
1091046165 11:132327798-132327820 AGGGAGACAGGAAGGAAGAAAGG - Intronic
1091142801 11:133250473-133250495 AGGGAGGGAAGAATGAAGAAAGG + Intronic
1202827876 11_KI270721v1_random:97496-97518 GGAGAAAGAAGAATGGAGAAAGG - Intergenic
1091692181 12:2604911-2604933 TGGGAGACAGGAGTAGAGAGTGG + Intronic
1091935933 12:4434536-4434558 TGGGTGAACAGAATGGTGAAAGG + Intronic
1092179193 12:6433721-6433743 AGGAAGAAAAGAAAGGAGAAGGG - Intergenic
1093227653 12:16504735-16504757 AGGGAGACAACTAAGGAGAAAGG - Intronic
1093259296 12:16915538-16915560 AGGGAGACAGGAATAAAGAAGGG - Intergenic
1093322399 12:17728986-17729008 GGGGAAAGAAGAAAGGAGAAAGG - Intergenic
1093398107 12:18708154-18708176 AGGGAGAAGAAAATGGAGAAAGG - Intronic
1093418770 12:18950698-18950720 TAGGGGAGGAGAATGGAGAAAGG + Intergenic
1093730456 12:22560328-22560350 AGGGAGACAAGACTGGAGGTAGG + Intergenic
1094079830 12:26521649-26521671 TGGGAGGGAGGAATGAAGAAAGG + Intronic
1094309686 12:29065944-29065966 GGGAAGAAAAGAGTGGAGAATGG - Intergenic
1094411999 12:30176505-30176527 AAGGTGAGAAGAATGGAGAATGG + Intergenic
1094818482 12:34207868-34207890 TGGCAGGCATGAATGGGGAAAGG - Intergenic
1095737797 12:45576652-45576674 TTGGAGGCAACAATGGAGAGGGG + Intergenic
1095975731 12:47939784-47939806 TGGAAGACAGGTATGGAGGAAGG - Intronic
1095980561 12:47972118-47972140 TGGGAGAGAGGGATAGAGAAAGG + Intergenic
1096568144 12:52498336-52498358 TGGGAGGCAAGAAGGGAGGTTGG + Intergenic
1096849485 12:54426566-54426588 TAGGAGAGAGGAAAGGAGAAAGG + Intergenic
1096938395 12:55310015-55310037 TGAGAGACTAGAGTGAAGAAAGG - Intergenic
1097079883 12:56422184-56422206 TGGAAGACCTGAATGGTGAAAGG + Exonic
1097314021 12:58152879-58152901 TTATGGACAAGAATGGAGAAAGG + Intergenic
1097443436 12:59639756-59639778 TATGAGACAAAATTGGAGAATGG - Intronic
1097908814 12:64947697-64947719 AAGGAGACCTGAATGGAGAAGGG - Intergenic
1097916084 12:65021642-65021664 TGGAAGGGAAGAATTGAGAAGGG + Intergenic
1098287079 12:68918195-68918217 GAGGAGCCAAGAATGGAGATGGG - Intronic
1098786892 12:74770662-74770684 TGGTAGAAGAGAATGAAGAAGGG + Intergenic
1099463087 12:82947907-82947929 TGGTAGACAAGGCTGAAGAATGG - Intronic
1099617234 12:84951421-84951443 AGGAAGAAAAGAAAGGAGAAAGG - Intergenic
1099644957 12:85341388-85341410 TGGGAGGTAAAAATGGGGAAAGG - Intergenic
1099808432 12:87549312-87549334 TGGGAGACAGGAAAGAAGAAAGG + Intergenic
1100658537 12:96672489-96672511 TAGGAGAAAGGAAGGGAGAAGGG + Intronic
1100681108 12:96921999-96922021 TGTGAGAAAAGATTGGAAAAGGG + Intronic
1100715076 12:97296828-97296850 AGGGAAACAGGATTGGAGAAGGG + Intergenic
1100894319 12:99162526-99162548 TGCAGGACAAGAATGGAGGAAGG - Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101830852 12:108255312-108255334 TGGGAGACAAGAGGGAGGAAGGG + Intergenic
1101970859 12:109310765-109310787 TGGCAGAGAAGAAAGGAGGAAGG - Intergenic
1102403499 12:112651742-112651764 AGGGAGAAGAGAATGGAGATGGG - Intronic
1102467249 12:113137126-113137148 GGGGAGTCAAGAAGGGAGACTGG - Intergenic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1103539032 12:121653211-121653233 TGGGAGAGAGGCATGAAGAACGG - Exonic
1103966225 12:124641576-124641598 TGGCGGACAAGATTGGAGAGTGG + Intergenic
1104301695 12:127570390-127570412 AGGAAGAGAAGAATGAAGAAAGG + Intergenic
1104356018 12:128087765-128087787 TGGGAGGGAAGAAAGGAGACAGG - Intergenic
1104702464 12:130917695-130917717 TGGGAGACAAGCACAGAGACTGG + Intergenic
1106181833 13:27376009-27376031 TGGGAAACAAGAAGGGAAATGGG - Intergenic
1106186596 13:27415236-27415258 AGGGAGAAAAGAATTGAAAAAGG - Intergenic
1106248891 13:27969209-27969231 TGGGAGGAAAGAAGGAAGAAAGG - Exonic
1106364887 13:29068956-29068978 TGGAAGACAGGAGTGGAGTAGGG + Intronic
1106732929 13:32560683-32560705 AGAGAGACAAGAATTGAGCATGG - Intergenic
1107282475 13:38752656-38752678 TAGGAGACAAAAATATAGAAAGG - Intronic
1107405738 13:40111047-40111069 AGGTAGACAATAAGGGAGAAAGG + Intergenic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108489150 13:50962911-50962933 AGGGAGGAAAGAATGGAAAAAGG - Intronic
1108862186 13:54875021-54875043 TAAGTGACAAGAATGAAGAAAGG + Intergenic
1109707008 13:66108659-66108681 TGGGAGATGTGAATGAAGAAGGG - Intergenic
1110051439 13:70905742-70905764 TGGCAGACAAGTATGTGGAAAGG - Intergenic
1110867995 13:80419910-80419932 AGAGAGAGAAGAAGGGAGAAGGG - Intergenic
1110944172 13:81391972-81391994 TGGGGGCCAGGAATGGAGACAGG - Intergenic
1111347899 13:86986473-86986495 TGACAGAAAAGAAAGGAGAAAGG - Intergenic
1112787088 13:102963074-102963096 TGGGGTCCAGGAATGGAGAAAGG - Intergenic
1113509126 13:110837939-110837961 GGGTAGTCAAGAAAGGAGAATGG + Intergenic
1113975513 13:114225264-114225286 AGGGAGAGAAGAAGGGAGAAGGG + Intergenic
1114673968 14:24429176-24429198 TGGGACACAGGTATGGAGAGGGG - Exonic
1114793637 14:25686920-25686942 TGGCAGATAAGAGTGTAGAAGGG + Intergenic
1115275601 14:31605813-31605835 GAGGAGACGAGAAAGGAGAAGGG - Intronic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115473504 14:33792398-33792420 TGTGAGAAAAAAAAGGAGAATGG + Intronic
1115497324 14:34019196-34019218 AGGGAGAGAAGAAGGGAAAATGG + Intronic
1115576399 14:34715721-34715743 TTAGAGACAAAAATTGAGAAGGG + Intergenic
1115628806 14:35222641-35222663 TGGGAGTCCAAAATGGGGAAGGG - Intronic
1115931743 14:38504569-38504591 TGGGAGATAAGAATGTAAATTGG - Intergenic
1115953911 14:38754979-38755001 TTGGAGAGAAGAAAGCAGAAGGG + Intergenic
1116411621 14:44631135-44631157 AGGGAGAGAAGGAGGGAGAAAGG + Intergenic
1117049553 14:51846744-51846766 TGGGAGGGAAGACTGGAAAAAGG - Intronic
1117335311 14:54752382-54752404 TGGGAGGCAAGAGTGGTGAGTGG + Intronic
1117575592 14:57094059-57094081 AGGCAGAAAAGAGTGGAGAATGG + Intergenic
1117908536 14:60614465-60614487 TGGGAGAAAAAAATGGAAAGGGG + Intergenic
1117918699 14:60705350-60705372 TGGGAGAGAAGGATGGATAAGGG - Intergenic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1119196932 14:72723964-72723986 TGGGCAAAAAGAATGGAAAAAGG - Intronic
1119640004 14:76307842-76307864 TGGGGAAAAAGAATGGAGCAGGG + Intergenic
1119971485 14:78975572-78975594 TCTGACACTAGAATGGAGAAAGG + Intronic
1120391383 14:83912667-83912689 TGACAGAAAAAAATGGAGAAAGG + Intergenic
1120933405 14:89871169-89871191 TGGCAGACAAGAGTGCAGGAGGG + Intronic
1121032801 14:90673930-90673952 TGGGAGTGAGGAATGGAGAGTGG + Intronic
1121447545 14:93988268-93988290 TGGGAGGAAAGGATGGAGGAGGG + Intergenic
1121447605 14:93988467-93988489 TGGGAGACAAGATGGGAGGAGGG + Intergenic
1121803297 14:96793509-96793531 TGGGAGAAAGGAAAGGAGAGAGG - Intergenic
1122057818 14:99116808-99116830 GGAGAGGCAAGAATGGGGAATGG + Intergenic
1123057214 14:105576255-105576277 GGGGAGAGATGGATGGAGAAAGG - Intergenic
1123081030 14:105695636-105695658 GGGGAGAGATGGATGGAGAAAGG + Intergenic
1123193969 14:106599092-106599114 AGAGAGAGAAGAAGGGAGAAAGG + Intergenic
1123831257 15:24140300-24140322 TGGAAGACAAAAATGGAAACAGG - Intergenic
1124348780 15:28940436-28940458 TGAGACAGGAGAATGGAGAATGG + Intronic
1124412340 15:29446821-29446843 TGGAAGTCAGGAATGGAGGAAGG - Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1125415008 15:39443260-39443282 AGAAAGACAAGAATGGAGAGAGG + Intergenic
1125684415 15:41555293-41555315 GGGGAGATAAGCAAGGAGAATGG + Intergenic
1125694412 15:41623221-41623243 TGGAAGAGAAGAATGAGGAAAGG + Intronic
1125720492 15:41842855-41842877 AGGGAGGCAAGGATGGAAAATGG + Intronic
1126167593 15:45666899-45666921 TGGGAGAAAGGAAAGGAGAGGGG - Intronic
1126241801 15:46453671-46453693 TGGAAGAGAAGAAAAGAGAAGGG - Intergenic
1126309162 15:47296253-47296275 TTGGAGAGATGAATGGAGAATGG + Intronic
1126704833 15:51397373-51397395 GGGGAGAGAAGAAGAGAGAAAGG - Intronic
1127304984 15:57696815-57696837 AGGGAGACAAAAAAGTAGAAGGG - Intronic
1127457298 15:59166847-59166869 TGGGACACAAGAGAGGAGAGTGG - Intronic
1127572861 15:60261379-60261401 TGGGAGGGAAGACTGAAGAATGG - Intergenic
1128110148 15:65071262-65071284 TGGGGGCAAAGAAAGGAGAAAGG - Intronic
1128157504 15:65401195-65401217 TGGGAGGGAAGAATGGAGGTAGG - Intronic
1128855211 15:71005166-71005188 TGGGAAAACAGAATGAAGAAGGG - Intronic
1129589024 15:76898757-76898779 AGGGAGGCCAGAATGGAAAACGG + Intronic
1129695262 15:77737402-77737424 AGGGAGGGAAGAAAGGAGAAAGG + Intronic
1130032691 15:80329743-80329765 TAGGAGAAAAAAATGGATAAAGG + Intergenic
1130243577 15:82221347-82221369 TGGAAGACAAGTAGGGAGAATGG - Intronic
1131556114 15:93400890-93400912 AGGGAGAGAAGAGAGGAGAAAGG - Intergenic
1131606532 15:93909690-93909712 TGGGAGGGAAGAAAGGAGAGAGG - Intergenic
1131755107 15:95551041-95551063 TGGCAGTCAAGAGAGGAGAAGGG - Intergenic
1133213442 16:4275816-4275838 TGGGAGACAAAATTGGACCAAGG - Intergenic
1133419244 16:5631638-5631660 TGGGAAACATGAATGCAGAAGGG - Intergenic
1133444222 16:5846345-5846367 TGGGAAAGAATAATGGGGAAAGG + Intergenic
1133474012 16:6102251-6102273 TGAGAGGGAAGAAAGGAGAAAGG - Intronic
1133731586 16:8582883-8582905 AGTGAGACAAGAAAAGAGAAAGG + Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1134569554 16:15279618-15279640 TGGGAGACAAGACTGGATTGCGG + Intergenic
1134686162 16:16160029-16160051 TGGGAGACAAGGTTGGGGATGGG - Intronic
1134732825 16:16476431-16476453 TGGGAGACAAGACTGGATTGCGG - Intergenic
1134902906 16:17954636-17954658 TGGGAGGAAAGAAAGGAGGAAGG + Intergenic
1134934617 16:18235540-18235562 TGGGAGACAAGACTGGATTGCGG + Intergenic
1135029616 16:19027684-19027706 TGGGAGAGTTGAAAGGAGAATGG + Intronic
1135178058 16:20248700-20248722 TGGGAGACAATAATGTACGAAGG - Intergenic
1135181767 16:20281083-20281105 AGGGAGAGAAGAATGAAGGAAGG - Intergenic
1135885748 16:26305656-26305678 TGGTAGACCAGAATGGCCAAGGG - Intergenic
1136390802 16:29963083-29963105 TGGAAGACAGGGAGGGAGAATGG - Exonic
1136474670 16:30505295-30505317 TGGGAGGTAAGAGGGGAGAAGGG + Exonic
1136494225 16:30632106-30632128 GGGGAGCCAAGATAGGAGAATGG - Intergenic
1136621713 16:31433826-31433848 TGGGAGACAGAAAAGGGGAAAGG + Intronic
1137599717 16:49748438-49748460 GGGGAGATGAGAATGGAAAACGG + Intronic
1137722469 16:50635473-50635495 TGGGAGACAAAACGGCAGAAAGG - Exonic
1137768070 16:50993018-50993040 AGGGAGAGGAGAAAGGAGAAGGG + Intergenic
1138219485 16:55238758-55238780 TGGAAGTCAAGAATAGAGATTGG - Intergenic
1138937607 16:61748711-61748733 TGGGAGAAGAAAATAGAGAAAGG - Intronic
1139121024 16:64017245-64017267 GGGGAAAGAAGGATGGAGAAAGG + Intergenic
1139472383 16:67185107-67185129 TGGGGGAAAAGATTGGGGAAGGG - Intronic
1139490254 16:67282143-67282165 TGGGAGAGAAGGAGGGAGACAGG - Intronic
1140029199 16:71321099-71321121 TGGGATAGATGAATGGAGAAGGG + Intergenic
1140117722 16:72057264-72057286 AGGCAGACAGGAAGGGAGAAAGG - Intronic
1140119957 16:72075017-72075039 AGGCAGACAGGAAGGGAGAAAGG - Intronic
1143544017 17:7585973-7585995 TGGGAGCCAAGAGTGCTGAAGGG + Exonic
1143586384 17:7852721-7852743 AGGCAGACAAGGATGGAGAGAGG - Intronic
1143652527 17:8272438-8272460 TAGGAAGCAAGAATGGATAAAGG - Intergenic
1143755924 17:9067574-9067596 TAAGAGACAGGAGTGGAGAATGG - Intronic
1144302094 17:13931063-13931085 TGGGAAGGAAGAGTGGAGAATGG - Intergenic
1145286894 17:21512548-21512570 TGGGAGAGGAGAAGGGGGAAAGG + Intergenic
1146423959 17:32718273-32718295 TGGCAGACTAGAAAGCAGAATGG - Intronic
1146475379 17:33158369-33158391 TGGGAGACAAGGTTGGGGAGAGG + Intronic
1146674854 17:34766211-34766233 AGGGGGACAAGACTGGAGATGGG + Intergenic
1147144538 17:38477535-38477557 GGGGAGACAGGAATGGTGAGAGG - Intronic
1147275825 17:39315623-39315645 TGGGATACAAGCAGGGTGAATGG + Intronic
1148225078 17:45893986-45894008 TGGGAAAAAAGCAAGGAGAAAGG + Intergenic
1148550388 17:48546791-48546813 GGGGAGAGGAGGATGGAGAAAGG + Intergenic
1148577890 17:48724253-48724275 TGGGAGACTAAAATTGGGAAGGG + Intronic
1149290148 17:55210068-55210090 TGGGAGAGAAAGAAGGAGAATGG + Intergenic
1149778757 17:59379360-59379382 TTGGAGAAAAGAATGGAAAAAGG + Intronic
1150025634 17:61671337-61671359 TAGTAAACAGGAATGGAGAAAGG + Intergenic
1150125189 17:62630572-62630594 TGGGAGGCCAGAATGGGGATGGG + Intronic
1150484410 17:65533752-65533774 GGGGAGAGAAGAAATGAGAAGGG + Intronic
1150882946 17:69051916-69051938 TGGGAAATAAGAATGGAGGTTGG + Intronic
1150911314 17:69390418-69390440 TTGGAGAAAAGAAAGGAGAGGGG - Intergenic
1150946578 17:69752862-69752884 TGGGAGATACGGATGAAGAAAGG - Intergenic
1151241687 17:72763181-72763203 TGGGAGGCAATGAGGGAGAAGGG - Intronic
1151365638 17:73614552-73614574 TGGGGGACAAGGATTGAAAAGGG + Intronic
1152870473 17:82751060-82751082 TGGGAGACGGGGATGGAGGATGG - Exonic
1153162590 18:2224970-2224992 TGGGAAGAAAGAATGCAGAAAGG + Intergenic
1153166023 18:2263042-2263064 TGGGAGACGAGGCTGGAGAAAGG + Intergenic
1153379816 18:4425777-4425799 GGGGAGAGAAGTAGGGAGAAGGG - Intronic
1154497237 18:14970914-14970936 TGGAAGAAAAGAATGAAGAAAGG - Intergenic
1155130978 18:22933902-22933924 GGGGAGAAATGGATGGAGAAGGG + Exonic
1155561312 18:27080291-27080313 TGAGAGACAAGTATGAACAAAGG - Intronic
1155788535 18:29933486-29933508 TGGAAGATATGAATGGAGCAAGG + Intergenic
1155905229 18:31442706-31442728 CGGGAGAGGATAATGGAGAATGG + Intergenic
1156013217 18:32517758-32517780 TGGGAGAGGGGAAAGGAGAAGGG - Intergenic
1156150821 18:34240986-34241008 TGGGAGAAAATATTTGAGAAAGG - Intergenic
1156257336 18:35410528-35410550 TGGGAGAGAGGATTTGAGAAAGG + Intergenic
1156356100 18:36341582-36341604 GGGGAGAAAAAAATGGAGATGGG + Intronic
1157201140 18:45660939-45660961 TGGCAGCCAAGAGTTGAGAATGG - Intronic
1158005033 18:52662523-52662545 TGGGAGGGAGGAAGGGAGAAAGG + Intronic
1158246106 18:55433838-55433860 AGGGACACAAGCAGGGAGAAAGG - Intronic
1158273128 18:55738096-55738118 AGGGAGAAAATAAAGGAGAAAGG - Intergenic
1158664355 18:59419302-59419324 TGGGAGGGAAAAATGGAAAATGG - Intergenic
1159394433 18:67838116-67838138 AGGGAGAAAAGAAGGAAGAAAGG - Intergenic
1159818203 18:73104064-73104086 TGAGAGATAATGATGGAGAAAGG + Intergenic
1159877073 18:73824529-73824551 AGGGAGAGAAGGAGGGAGAAAGG + Intergenic
1162445440 19:10719599-10719621 TGGGAGACAAGAAAGGCAAGAGG - Intronic
1162683956 19:12366138-12366160 TGGGAGATAAGGTGGGAGAAAGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163499264 19:17666014-17666036 TGAAAGACAAGAAGGAAGAAAGG - Intronic
1164657970 19:29938578-29938600 TGGGAGACAAGAGTTGACCAAGG - Intronic
1164731006 19:30504451-30504473 TGGGAGGGAGGAAGGGAGAAAGG - Intronic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164794467 19:31014865-31014887 AGGGAGAAAAGAAGGGAAAAAGG + Intergenic
1164794472 19:31014907-31014929 AGGAAGAGAAGAATGGAGAGAGG + Intergenic
1165100538 19:33436116-33436138 GGGGAGAAAAGAAGGGAGAAGGG + Intronic
1166556439 19:43703176-43703198 AGGAAGGCAAGAAGGGAGAAAGG - Intergenic
1166885751 19:45960089-45960111 TGGGGGAGAAGGATGGAGCAGGG + Intronic
1167473335 19:49687152-49687174 TGGGAGGCATGAGAGGAGAAAGG + Intronic
1168414663 19:56160522-56160544 AGGGAGAGAGGAATGGAGGAGGG - Exonic
925032199 2:659627-659649 AGGGAGAAAAGAAGGAAGAAGGG + Intergenic
925454940 2:4008049-4008071 AGGGAGGCAAGAATGGAGGGAGG + Intergenic
925711604 2:6746534-6746556 TGGGAGAGAAGAATGGGCAGAGG + Intergenic
926241538 2:11092694-11092716 TGGGAGGCAAGAAGGGGAAATGG + Intergenic
927247693 2:20971051-20971073 TGGGAGAAGAGAAGGGAGAGTGG - Intergenic
927511088 2:23643982-23644004 TGGGAGAGAAGACAGGAGAGTGG - Intronic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928036415 2:27828324-27828346 GGGGAGGCAGGAAAGGAGAAAGG + Intronic
928216012 2:29361994-29362016 AGGGAGAGAAGGATGGAGAAAGG + Intronic
928644628 2:33339049-33339071 AGGGAGGCAAGACTGGAGATGGG + Intronic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
929007451 2:37409860-37409882 TGGGAGCCAAGAATGGTGTGGGG + Intergenic
929298263 2:40272350-40272372 AGGGAGATAAGGAGGGAGAAAGG + Intronic
929349961 2:40938675-40938697 AGGAAGAAAGGAATGGAGAAAGG + Intergenic
929667266 2:43842709-43842731 GGGGAGAGATGAAAGGAGAAAGG - Intronic
931133384 2:59366200-59366222 GGGGAGAGAAGAAGGAAGAAGGG + Intergenic
932552563 2:72785982-72786004 GGGGAGCCAAGACAGGAGAATGG + Intronic
932673732 2:73759837-73759859 TGGGGAACAAAAATGGAGAGGGG - Intergenic
932780007 2:74553994-74554016 TGGGAGGGACGAACGGAGAAGGG - Intronic
933191778 2:79341976-79341998 TGAGTGTCAAGAATGGTGAACGG - Intronic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
934851926 2:97707154-97707176 TGGGAGATTTGAATGGAGGAGGG + Intergenic
936059395 2:109284449-109284471 TGGGAGGCAGGCATGCAGAAGGG + Intronic
936150306 2:110015684-110015706 TTGTAGAGAAGAATTGAGAATGG + Intergenic
936194368 2:110355691-110355713 TTGTAGAGAAGAATTGAGAATGG - Intergenic
936411720 2:112264473-112264495 TAGGAGACCATAATGAAGAAGGG + Intergenic
936893835 2:117404528-117404550 TGGAAGGGAAGGATGGAGAATGG + Intergenic
936957457 2:118037284-118037306 AGGAAGACAAGAATGGAAAATGG - Intergenic
937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG + Intergenic
937693685 2:124784166-124784188 TGGGAGGGAAGAAGGGAGGATGG + Intronic
938851276 2:135263097-135263119 TGGGAGAGAAGAATGGATATGGG - Intronic
939039107 2:137166736-137166758 TAGCAGACAAGGATGGAAAATGG - Intronic
939115841 2:138059485-138059507 TAGGAGAAAAAAATGGAGATAGG - Intergenic
939346625 2:140974588-140974610 TAGGAGATTAGAAGGGAGAAAGG + Intronic
939561781 2:143741013-143741035 GGTGGGACAAGAATGGAGGAGGG - Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
940336166 2:152529766-152529788 GGGGAGAGAAAAAGGGAGAAAGG + Intronic
940722290 2:157295153-157295175 TAGGAGACAGGAGTGGGGAATGG - Intronic
941248815 2:163135680-163135702 TAGAAGATAAGAATGAAGAAAGG - Intergenic
942380293 2:175384165-175384187 TGGAAGACAGAAATGGAGAAGGG + Intergenic
942504602 2:176628339-176628361 TGGGACGCAAGAAGTGAGAAGGG + Intergenic
943272532 2:185825421-185825443 TGGGACACCAGAAGGGAGGAGGG + Intronic
943612290 2:190047285-190047307 TGGGAAAGAAGAAGGAAGAAGGG - Intronic
944474118 2:200086591-200086613 GGGGACAGAAGAAAGGAGAATGG - Intergenic
944761231 2:202816653-202816675 TGGGATTCAGAAATGGAGAAAGG - Intronic
945686267 2:212974273-212974295 CTGGTGACAAGAAGGGAGAATGG + Intergenic
945978919 2:216292946-216292968 GAGGAGAGATGAATGGAGAAGGG + Intronic
946014688 2:216594499-216594521 TGGGAGGCAAAAATGGATATTGG - Intergenic
946015214 2:216598873-216598895 TGGGAGAGGAAAGTGGAGAAAGG - Intergenic
946069297 2:217017736-217017758 TGGGACTTAAGAATGGAGATGGG - Intergenic
946193332 2:218019227-218019249 GGAGAGAGAAGAATGGAAAAGGG + Intergenic
947077766 2:226364042-226364064 AGGGAGACAGGAAGGGAGAGAGG + Intergenic
947378824 2:229525040-229525062 AGGGAAACAAGGATGGAGGAAGG - Intronic
947610240 2:231520684-231520706 TAGAAGACAAGAATAGGGAAAGG + Intergenic
947614791 2:231548881-231548903 AGGGGCACAAGAAAGGAGAAGGG - Intergenic
948086364 2:235252827-235252849 AGGGAGAGAGGAAGGGAGAAAGG + Intergenic
948504413 2:238418309-238418331 GGGGAGACAACACAGGAGAAGGG - Intergenic
948930530 2:241129021-241129043 TGGGAGACATGGAGGGAGAGAGG - Intronic
1168792169 20:585367-585389 AGGGAGACAGGGAAGGAGAAAGG - Intergenic
1169235382 20:3926039-3926061 TGGGTGGCCAGAATGGAGAGGGG + Intronic
1169743043 20:8915980-8916002 TGGGAGATGTTAATGGAGAATGG - Intronic
1169928523 20:10807848-10807870 GGGCAGAGAAGAGTGGAGAATGG + Intergenic
1170038602 20:12016832-12016854 TGGAGGAGAAGCATGGAGAAGGG + Intergenic
1170666724 20:18393090-18393112 TGGGGCCCAAGAAAGGAGAAGGG + Intronic
1170798310 20:19569515-19569537 GGGCAGAGAAGAATGGAGAATGG - Intronic
1171151914 20:22834911-22834933 AGGGAGAGAGGAAAGGAGAAAGG - Intergenic
1171497499 20:25566222-25566244 TGGGAAACAAAAATGGACACGGG + Intronic
1172307667 20:33892843-33892865 TAGGGGACAAGAATGGAGCTGGG - Intergenic
1172845081 20:37925449-37925471 TGGGAGCCAAGGATGGAGGACGG - Intronic
1172942103 20:38661111-38661133 TGGGAGGCTAGTAGGGAGAATGG + Intergenic
1172980443 20:38937576-38937598 TGGGACACAGGAATGGGGGATGG + Intronic
1173328572 20:42055437-42055459 GAGGAGGCAAGAATGGAGAGAGG + Intergenic
1174917410 20:54668264-54668286 TGGCTGATAAGACTGGAGAAGGG + Intergenic
1175443394 20:59005743-59005765 TGGGAGAGAAGGCGGGAGAAGGG - Intronic
1175723763 20:61303197-61303219 TGTGAAACAAGAGTGGAGAGTGG + Intronic
1175982579 20:62746497-62746519 TGGGAGGGAGGAAGGGAGAAAGG + Intronic
1177316938 21:19474410-19474432 GGGGAAAAAAGAATGGAGAGGGG - Intergenic
1177412553 21:20749233-20749255 TAGGAGACAGGATTTGAGAAGGG - Intergenic
1177448304 21:21228749-21228771 TGGGAGGCAAGAAAGGAGAAGGG + Intronic
1177744589 21:25196072-25196094 AGGGAGAAAAGAAAGAAGAAAGG - Intergenic
1178069383 21:28946247-28946269 TTGCAGACAAGAATTGAAAATGG + Exonic
1178164759 21:29961243-29961265 AGGGAGAAAAGTATAGAGAAAGG + Intergenic
1179084814 21:38207421-38207443 AGGGAGAGGAGAAGGGAGAAGGG - Intronic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180904568 22:19400042-19400064 TGGGAGCCCAGAAAGGAGAAGGG + Intronic
1180926952 22:19561850-19561872 TTGGAAACAAGAATGGAAATGGG - Intergenic
1181471671 22:23144309-23144331 GGGGAGACAAGGAAAGAGAACGG - Intronic
1182008317 22:26979685-26979707 TGGGAGAAAGGAAGGAAGAAAGG - Intergenic
1182086292 22:27563447-27563469 TGGGAGACAAGGATGGAGGTAGG + Intergenic
1182408510 22:30160005-30160027 TGGAAAAGAAGAATGGAGAGAGG - Intronic
1183153123 22:36053625-36053647 AGGGAGAAAGGAAGGGAGAAGGG - Intergenic
1183336855 22:37253757-37253779 TGGGGCAGGAGAATGGAGAATGG - Intergenic
1183983534 22:41556589-41556611 TGGGAGACAAGGAGAGAGGAAGG + Intergenic
1184078883 22:42203761-42203783 AGGGAGAGGAGAATGGAGAAAGG + Intronic
1184100568 22:42339920-42339942 TGGGAGACAAGAATGGGCCTGGG + Intronic
1184872419 22:47249433-47249455 TGGGAGAGAAGTAGGGAGAGGGG - Intergenic
949598412 3:5572639-5572661 TTGGTGAAATGAATGGAGAAGGG + Intergenic
949894015 3:8755928-8755950 CGGGAGGCAAGAAGGGAAAAGGG + Intronic
950377099 3:12580865-12580887 CGGGAGACAAGAACAGGGAAAGG - Intronic
950394996 3:12727504-12727526 TGGGAGACAAGAATGAAAGTTGG + Intergenic
950407636 3:12814630-12814652 TGGGACTCCAGAAGGGAGAAGGG - Intronic
950737660 3:15023326-15023348 TGGCAGACAAAGATGGAGCAAGG + Exonic
951354472 3:21647385-21647407 AGGGAGAGAAGAAGGAAGAACGG - Intronic
951659536 3:25047235-25047257 TGGGAGATTAGAATGGCAAATGG + Intergenic
952771098 3:37001458-37001480 AGGGAAAAAAGAATAGAGAAAGG + Intronic
952842729 3:37661985-37662007 TGAGAGACAGGGAAGGAGAAAGG + Intronic
953028493 3:39159710-39159732 TGGAAAGCAAGAATGCAGAAAGG + Intergenic
953042943 3:39271074-39271096 TGGGAAAAAGGAATGGGGAAGGG - Intronic
953147198 3:40289756-40289778 TGGGAAATAAGAAAGGAGGAGGG + Intergenic
953150403 3:40319387-40319409 TGAGGGACAAGAAGGGAGATGGG - Intergenic
953386418 3:42508757-42508779 TGGGAGGCAAGAGGGGAGAGAGG - Intronic
953675850 3:45001512-45001534 AGGGAGACAGGAATTGAAAAAGG - Intronic
954464596 3:50647039-50647061 TGGGAGAAGAGGATGGAGTAGGG + Intronic
954613813 3:51959532-51959554 TGGGACACATTACTGGAGAAGGG - Intronic
954813837 3:53265007-53265029 TGAGAAACAGGACTGGAGAAAGG - Intergenic
955005374 3:54963833-54963855 TGGGAGAAAGGAATGGAGGAAGG + Intronic
955061685 3:55497856-55497878 TGGAAGAAAAGGATGGAGAAGGG + Intergenic
955726180 3:61935193-61935215 TGAGAGACAAGGATGGGGGAAGG - Intronic
956121833 3:65974303-65974325 TGGGAGGGAAGAAGGGAGAGTGG + Intronic
956834357 3:73083700-73083722 GGGGAGACAAGAATAGAAAAAGG - Intergenic
957797784 3:85034261-85034283 TGGGGGGCAAGAAGGGGGAATGG - Intronic
957847121 3:85752423-85752445 AGGGAGAGAAGAAAAGAGAAGGG - Intronic
958842207 3:99220271-99220293 AGGGAGACAAGAAGAAAGAAAGG + Intergenic
959084531 3:101837081-101837103 CCAGAGAAAAGAATGGAGAATGG - Intronic
959500188 3:107098251-107098273 TGAGACACAAGAATAGGGAATGG - Intergenic
959596128 3:108130277-108130299 TGGGAGGCAGCAAGGGAGAAGGG + Intergenic
959651615 3:108756340-108756362 AGGGAAACAAGAATGGGCAAGGG + Intronic
959860174 3:111207408-111207430 TGGAACATAAGATTGGAGAAGGG - Intronic
960463604 3:117967886-117967908 TGGGCTACAAGAGAGGAGAAGGG + Intergenic
960498105 3:118400494-118400516 TGAGAGAGAGTAATGGAGAAAGG + Intergenic
960570601 3:119181867-119181889 TGGGAGGAAAGAATGCAAAAGGG + Intronic
960889127 3:122427924-122427946 GAAGAGAAAAGAATGGAGAAAGG - Intronic
961017252 3:123477976-123477998 TGAGAGAGAAGAAAGGAGAGGGG + Intergenic
961212063 3:125133095-125133117 GGGGATACAAGAATGGACATGGG + Intronic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962744528 3:138387718-138387740 AGGAAGAGAAGAAAGGAGAAAGG - Intronic
963085726 3:141434427-141434449 GGGGAGGCTAGGATGGAGAAGGG + Intronic
963160686 3:142148824-142148846 TGTGAGTCATGAAAGGAGAAGGG + Intronic
963390913 3:144663118-144663140 AGGGAGGCAGGAATGAAGAAAGG - Intergenic
964070121 3:152621390-152621412 TGGGACAGAAGACAGGAGAAAGG + Intergenic
964379492 3:156083608-156083630 TAGGAGACATTAATGGAGCAGGG - Intronic
964836953 3:160949624-160949646 TGGCAGAAAAGGATGGGGAATGG - Intronic
965164021 3:165171438-165171460 TGTGTGACAAGAATTAAGAAGGG - Intergenic
965173061 3:165293752-165293774 AGGGAGAGAAGGAGGGAGAAGGG + Intergenic
965674498 3:171180339-171180361 TGGGGGACAAATATGGGGAAGGG - Intronic
966018008 3:175167070-175167092 AAGGAAACAAGAATGGAGACAGG - Intronic
966430142 3:179823445-179823467 GGGGAGAAAAGACTAGAGAAAGG + Intronic
966743975 3:183258311-183258333 TGGGAGAAAGAAAAGGAGAAGGG - Intronic
966762734 3:183431595-183431617 TGGGTGAGAGGAAGGGAGAAGGG - Intergenic
966989031 3:185210033-185210055 AGGAAGACAAGAATGGACAATGG + Intronic
968042296 3:195598880-195598902 TGGGTGAAAATAATGGAGGAGGG + Intergenic
968266273 3:197365925-197365947 AGGGAGAGAAGAAAGGCGAAAGG - Intergenic
968379059 4:73260-73282 GGAGAGAGCAGAATGGAGAATGG + Intronic
969120031 4:4901553-4901575 AGGGAGTCATGAATGGGGAAAGG - Intergenic
969352553 4:6606168-6606190 AGGGAGAGAAGAAGGGAGAGGGG + Intronic
969563787 4:7965799-7965821 GGGGAGAGAAGGATGGAGATAGG - Intronic
969700574 4:8765498-8765520 TGGGGGACAAGAGTAGGGAAGGG + Intergenic
969926720 4:10592486-10592508 AGGGAGAGAAGGATGGAGAAAGG - Intronic
969966345 4:11000752-11000774 TGGAAGAGAAGAATGTGGAAAGG - Intergenic
970460464 4:16269740-16269762 TGGGTGACCAGAAGGAAGAATGG + Intergenic
970652889 4:18197953-18197975 TGGGAAAAGAGAATGGAGAGGGG - Intergenic
970840394 4:20461951-20461973 TGGCAGTGGAGAATGGAGAAAGG + Intronic
971210976 4:24615969-24615991 TGGGAGAAAAGTAAGAAGAATGG + Intergenic
971799105 4:31265727-31265749 TCGGAGAGGAGAAGGGAGAAAGG + Intergenic
972727850 4:41761187-41761209 AGGGAGAGAAGGAGGGAGAAAGG + Intergenic
973587272 4:52405880-52405902 TGGGAGATAAGAAGGGTGAGGGG + Intergenic
973757155 4:54086599-54086621 TGGGAGAAAAAAATAGAGCATGG + Intronic
975107898 4:70589988-70590010 TGGGAAACAAGATTGGAAAGAGG + Intergenic
975952056 4:79785855-79785877 TGGGAGACAAAGATGAAGACTGG + Intergenic
975969416 4:80015788-80015810 TGGGAGAGAAGAAAGAAGGAAGG + Intronic
976151252 4:82094513-82094535 TGGTAAACAAGATTGAAGAATGG - Intergenic
976767984 4:88618444-88618466 GGGTAGAGAAGAAAGGAGAAAGG - Intronic
977389439 4:96389007-96389029 AGGGTAACAAGAGTGGAGAATGG + Intergenic
977926958 4:102711919-102711941 TGGCAGAGAGGAATGAAGAAAGG + Intronic
978016058 4:103748367-103748389 GGTCAGACAAGAATGGAGATGGG - Intergenic
978330199 4:107604228-107604250 TGGGAGAAATGAATGGAGTAAGG - Intronic
978337965 4:107689914-107689936 TGGGAGAGCAGAATGAAGCATGG - Intronic
978377387 4:108089296-108089318 TGGGAGAAAAGACTGGAGCTGGG - Intronic
978842106 4:113227347-113227369 TAGGAGACAAGAATGGAAGTAGG - Intronic
978896662 4:113896343-113896365 TGGGACTCAGGTATGGAGAAGGG + Intergenic
979028792 4:115612403-115612425 TGGTTGACAAGGATTGAGAAAGG + Intergenic
979696568 4:123619334-123619356 AGGCAGAGAAGAATGGAGAGGGG - Intergenic
979890145 4:126082143-126082165 TGGAAGGCAAGAATGGAAACAGG + Intergenic
979931192 4:126632962-126632984 AGGGAGAAAAGAAGGGAGAGGGG + Intergenic
980821255 4:138020680-138020702 TGAGAGCCAAGAAAGGACAATGG + Intergenic
981152385 4:141394468-141394490 TGTGAGACAAGAGTAGAAAAAGG + Intergenic
981638656 4:146910897-146910919 GAGGAGAAAAGTATGGAGAAAGG + Intronic
982186962 4:152812430-152812452 TGGGAGGCCAGGAGGGAGAATGG - Intronic
982482980 4:155934257-155934279 TAGAAGACAAGAATTGAGATTGG + Intronic
982642762 4:157983830-157983852 GGGGAGACCAGAATGGGGAAAGG - Intergenic
982686718 4:158499271-158499293 TAAGAGCCAAGAAAGGAGAAAGG + Intronic
982830426 4:160053310-160053332 TTGGAGGAAAGAATGTAGAATGG - Intergenic
982979366 4:162112566-162112588 TGGAAGAAAATAATTGAGAAAGG - Intronic
983089818 4:163490069-163490091 AGGGAGACAAGGAGGGAGAGAGG - Intergenic
983585732 4:169352701-169352723 TGGGAGGAGGGAATGGAGAATGG + Intergenic
984590249 4:181609071-181609093 AGGAAGACAGGAAAGGAGAAAGG + Intergenic
984681175 4:182610675-182610697 TGGGAGAAAAAAATAGAGAGAGG - Intronic
985044481 4:185926393-185926415 AGGGAGACAAAAAAGGAGATAGG + Intronic
985202742 4:187501451-187501473 TGGGAGACACGGATGCAGAGGGG - Intergenic
986173813 5:5334803-5334825 GGGGTGAGAAGAATGGATAAGGG - Intergenic
986816144 5:11414084-11414106 AGAGAGACAAAAATGGAGAAGGG + Intronic
987198656 5:15552653-15552675 TGGGAGGCAAGAGTGGAGATGGG - Intronic
987519380 5:18959525-18959547 TGGTAGACAAAAATTCAGAAAGG - Intergenic
988191173 5:27936967-27936989 TGTGAGACAAAAGTGCAGAAAGG + Intergenic
988725349 5:33920974-33920996 TGGGAGAGAAAAATGGGAAAAGG - Intergenic
988919526 5:35927447-35927469 GGGGAGAGAAGAAAGGAGAAAGG + Intronic
989210097 5:38850385-38850407 AGGGAGAGAAGAAGGAAGAAAGG - Intronic
989490441 5:42046829-42046851 GGGAAGAGAAGAAAGGAGAAGGG + Intergenic
990106694 5:52272437-52272459 AGAGAGAGAAGAATGGGGAAAGG + Intergenic
990213282 5:53503885-53503907 GGAGAGAGAAGGATGGAGAACGG - Intergenic
990232772 5:53732654-53732676 TGGGAGAAAAACATGCAGAAGGG + Intergenic
990464078 5:56055957-56055979 AGGAAGACTAGAATGGAGAATGG - Intergenic
990688722 5:58337873-58337895 AGGGAGAAAAGGAGGGAGAAAGG + Intergenic
991607949 5:68422171-68422193 TGAGAGACAAGCACGGAGAAAGG + Intergenic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
992331781 5:75724405-75724427 TGAAAGGGAAGAATGGAGAAAGG - Intergenic
992546073 5:77815165-77815187 TGTTACACAGGAATGGAGAATGG + Intronic
992632701 5:78697345-78697367 TGGGAGCCAAGGCAGGAGAAGGG + Intronic
993126283 5:83839748-83839770 TTGGAGGCAAGAACGGAGACAGG - Intergenic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994561415 5:101378396-101378418 TGGGACACTAGAAGGGAGAGAGG - Intergenic
996167410 5:120242287-120242309 TGGGAGGGAAGAAAGGAGGAAGG - Intergenic
996231731 5:121071765-121071787 TGGTAGACAAGACTGGGGATTGG + Intergenic
996293685 5:121885930-121885952 TGTGAGAGAGCAATGGAGAATGG + Intergenic
996338278 5:122408418-122408440 TGGGCTCCAAGAATGGAAAATGG + Intronic
996405597 5:123099628-123099650 CGGGAGACAAGAAGGAGGAAGGG - Intronic
996769053 5:127066359-127066381 TGGGGGGCAAGAGTGGAGCAGGG + Intronic
996872664 5:128208892-128208914 TGGGATACAAGAAAGGGAAAGGG - Intergenic
997691740 5:135831999-135832021 TGGGAGAGAGAAATGGAGGATGG + Intergenic
997692095 5:135833937-135833959 AGGTTGACAAGAATGGTGAAGGG - Intergenic
998905499 5:146900494-146900516 AGGGAGAAAGGAAAGGAGAAAGG - Intronic
999234692 5:150083327-150083349 TGGGAGAGAAGAGTAGAGATTGG - Intronic
999519428 5:152335452-152335474 AGAGAGACAAGAAGGGAGATAGG + Intergenic
999547292 5:152643858-152643880 TGAGAGAAAACAATGGAAAAAGG - Intergenic
999648027 5:153738320-153738342 TGGGAGACAAGAGTAGGGAAAGG + Intronic
1000046275 5:157524319-157524341 ATGGAGAACAGAATGGAGAATGG - Intronic
1000366306 5:160494430-160494452 GGGCAGAGAAGAGTGGAGAATGG + Intergenic
1000488295 5:161876694-161876716 TGGGAAAAAAGCAGGGAGAAGGG - Intronic
1000712103 5:164593186-164593208 TGAGAGAGAAGAAAGGAAAAAGG - Intergenic
1000926228 5:167197955-167197977 GGGGAGAAAAGAAAGGAGAAAGG + Intergenic
1000994379 5:167944245-167944267 GGGGAAACAAGAAAGGATAAGGG - Intronic
1001018317 5:168161678-168161700 TGGGGGAGAAAAGTGGAGAAAGG - Intronic
1001689020 5:173618406-173618428 GGGGTGCCAAAAATGGAGAAGGG - Intergenic
1001899598 5:175415081-175415103 AGGGAGAAAAGAAGGGAGAATGG - Intergenic
1002270226 5:178066962-178066984 TGGGAGAGAAGCAGGGAGGAAGG + Intergenic
1002825355 6:767999-768021 AGGAAGAAAAGAAGGGAGAAAGG - Intergenic
1003087828 6:3075330-3075352 TGGAAGAAAAGAAGGGAGGAAGG + Intronic
1003341608 6:5226936-5226958 TGTGAGAAGAGAATGGGGAAGGG + Intronic
1003551300 6:7104474-7104496 TGGGAGACAGGGAGGGGGAAGGG + Intergenic
1003734459 6:8862779-8862801 TGGGAAACGAGGCTGGAGAAAGG + Intergenic
1003899748 6:10643353-10643375 AGGAAGAGATGAATGGAGAAGGG - Intergenic
1004026348 6:11823059-11823081 TGGGAGAAAGGCAGGGAGAAAGG - Intergenic
1004036321 6:11927679-11927701 TGGAAGTCAAGGATGGAGGAGGG + Intergenic
1004653067 6:17630719-17630741 GGGGAGACAAGAGGGGAGAGGGG + Intronic
1004751489 6:18566229-18566251 AGGGAGAGAAGAAGGAAGAAAGG - Intergenic
1004792312 6:19040385-19040407 GTGAAGAGAAGAATGGAGAAGGG + Intergenic
1004993455 6:21164511-21164533 TGGGAGACAATGATGGATAGTGG - Intronic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1005943062 6:30575537-30575559 AGGGAAACAAGGATGGAGAGGGG + Intronic
1005959124 6:30683901-30683923 AGGGAGAAGTGAATGGAGAAAGG - Intronic
1006184703 6:32175198-32175220 ATGGACACAAGAATGAAGAATGG + Intronic
1006205852 6:32342126-32342148 TGGAAAAAATGAATGGAGAAGGG - Intronic
1006336846 6:33425441-33425463 TGGGAGGAAAGCAGGGAGAATGG + Intronic
1006384207 6:33720152-33720174 AGGGTGACAGGAGTGGAGAAGGG - Intergenic
1006609638 6:35286433-35286455 TGGGAGGCAGGACTGGAGGATGG + Intronic
1008673020 6:53793351-53793373 TGGAATGCAAGAATGTAGAAAGG + Intergenic
1008772900 6:55001175-55001197 AGTGAGACAAGAAAGAAGAAAGG - Intergenic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1010917634 6:81640787-81640809 AGGGAGATAAGGATGGAGGAAGG - Intronic
1011106334 6:83785831-83785853 TGGGAGAGAAAGAAGGAGAAGGG + Intergenic
1011925954 6:92644956-92644978 TGGGAGACTAAAATTGGGAAGGG - Intergenic
1012030241 6:94050989-94051011 TGCTGGACAAGAGTGGAGAAAGG + Intergenic
1012219452 6:96630455-96630477 TGGGAGAAAAGAATGAACAAAGG - Intergenic
1012505105 6:99936459-99936481 AAGGAGCCAAGAATGGAGACAGG - Intronic
1013601267 6:111707260-111707282 TGGGTCAGAAGAAGGGAGAAAGG + Intronic
1014433843 6:121399940-121399962 GGGGAGAAAAGAATGGAAACCGG - Intergenic
1014796668 6:125732751-125732773 TGGGAGACAGGAATTCAGAAAGG - Intergenic
1014890182 6:126834760-126834782 TGGGAGACAAGGATGGACGAAGG - Intergenic
1014999179 6:128192903-128192925 AGGAAGAGAAGAAGGGAGAAAGG + Intronic
1015118518 6:129675891-129675913 TTGCGGACAAGAATGGAGGAGGG - Intronic
1016375705 6:143418463-143418485 AGGGAAACAAAAAAGGAGAAGGG + Intergenic
1016814265 6:148289261-148289283 TGGAAGGCAAGAAAAGAGAAGGG + Intronic
1016850122 6:148610513-148610535 AAGGAGACAAGAATGAAGATAGG - Intergenic
1017154336 6:151309411-151309433 TGGGAGAAAATAATGAACAAGGG + Intronic
1017777739 6:157692548-157692570 TGGGAGACATGAATGGGGCAAGG - Intergenic
1019310350 7:357405-357427 AGGGAGAGAGGAAAGGAGAAGGG + Intergenic
1019553473 7:1616765-1616787 TGGGAGCCAAGCAGGGAGATGGG - Intergenic
1019660410 7:2220796-2220818 TGGGAGTCAACAAAGAAGAAAGG + Intronic
1019843205 7:3470199-3470221 AGGGAGAGAAGAAGGGAGAAAGG - Intronic
1020672081 7:11128724-11128746 TGGGAGAGACGGAAGGAGAACGG - Intronic
1020893675 7:13912237-13912259 TGGGAGAAAAGGAGGGAGAAAGG + Intronic
1022266889 7:28765572-28765594 AGGTAGACAGGAAGGGAGAAAGG + Intronic
1022474387 7:30700354-30700376 TGGGAGAGAGGAATTGAGACAGG + Intronic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1022738781 7:33101274-33101296 AGGGAGTCAAGAATAGACAAAGG + Intronic
1023834326 7:44059479-44059501 TGGGGGACAGCAGTGGAGAAGGG + Intronic
1023859838 7:44212006-44212028 TGTGAGAAAAGAAAGGAAAAAGG + Intronic
1024173832 7:46818095-46818117 TGTAAGACAAGACTGGAGAGAGG + Intergenic
1024263665 7:47590264-47590286 AGGGAGAGAAGGATTGAGAAAGG - Intergenic
1024278875 7:47701523-47701545 AGGGAGGAAAGAAGGGAGAATGG + Intronic
1025488136 7:61077435-61077457 AGGGAGGGAGGAATGGAGAAAGG - Intergenic
1025874933 7:65472345-65472367 TGGCAGCAAAGAATGAAGAAGGG + Intergenic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1026857249 7:73762861-73762883 AGGGAGAAAGGAAAGGAGAAAGG - Intergenic
1026953006 7:74360082-74360104 TGGGAGACAGGCAAGGAGCAGGG - Intronic
1026955005 7:74371564-74371586 GGGGAGACAGGAAGGGAGAGAGG + Intronic
1027277905 7:76580463-76580485 TGAGAGAGAAGAATTAAGAACGG + Intergenic
1027729191 7:81848221-81848243 GAGGAGACAAGAATGGACAAGGG + Intergenic
1027821654 7:83053468-83053490 TGGAAGAAAAGAATGGAGGAAGG + Intronic
1027856650 7:83520398-83520420 ACGGAGAAAGGAATGGAGAAAGG - Intronic
1027905759 7:84179410-84179432 TGCAAGAAAAAAATGGAGAATGG - Intronic
1028077754 7:86535695-86535717 TGGGAGGCAAAAAAGGAGTATGG + Intergenic
1028610722 7:92708223-92708245 GGTGAACCAAGAATGGAGAATGG + Intronic
1028611952 7:92721395-92721417 AGGGAGACAAGGCTGGAGTAGGG + Intronic
1028657185 7:93221891-93221913 TGGCAGAAAAGAATACAGAAGGG - Intronic
1028756448 7:94440483-94440505 TGAAAGACAAGAATACAGAACGG - Intergenic
1029097759 7:98102620-98102642 GGGGAGAGAAGAATGGAAATAGG + Intergenic
1030121910 7:106118457-106118479 AGGGAGACAGGAAAGAAGAAAGG + Intergenic
1030662015 7:112229989-112230011 TAGGAGACAAGGCTAGAGAAGGG + Intronic
1030892985 7:115023827-115023849 TGGGAGACAAGAAACAAGACAGG - Intergenic
1031454159 7:121958751-121958773 TGGGAGTGAGGAAGGGAGAATGG - Intronic
1031955395 7:127937445-127937467 AGGGAGAGGAGAAGGGAGAAGGG - Intronic
1032686008 7:134234476-134234498 TTGGAAACAACAATGAAGAAAGG - Intronic
1033015175 7:137663866-137663888 GGGGAGGGAAGAAAGGAGAAAGG + Intronic
1033731777 7:144187510-144187532 TGGGAGACAAGGAGAAAGAATGG - Exonic
1033742626 7:144286093-144286115 TGGGAGACAAGGAGAAAGAATGG - Intergenic
1033751277 7:144363521-144363543 TGGGAGACAAGGAGAAAGAATGG + Exonic
1033764046 7:144468305-144468327 TTGGAGACAGGGATGGAGAGTGG + Intronic
1034490985 7:151392905-151392927 AGGGAGCCAAGACTGAAGAATGG - Intronic
1034897803 7:154888653-154888675 TGGAAGAGAAGAAGGGAAAAAGG - Intronic
1034973174 7:155431817-155431839 TGGGACACCAGACTGGAGAGAGG - Intergenic
1035308858 7:157952339-157952361 TGGGGGACACGAAGGGAGACAGG + Intronic
1035593379 8:835482-835504 TGGGAGAGGAGGATGGAGAGAGG - Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1036282789 8:7415961-7415983 TGGAAGGGAAGGATGGAGAAAGG - Intronic
1036338677 8:7895566-7895588 TGGAAGGGAAGGATGGAGAAAGG + Intronic
1037083176 8:14812727-14812749 TAGAAGACAGGAATGAAGAATGG - Intronic
1037256230 8:16958080-16958102 TGTGAGACCACAATGGTGAAAGG + Intergenic
1037491081 8:19397695-19397717 TGGGAGAGAAGAATCTAGATGGG - Intergenic
1037637133 8:20710278-20710300 TGGAAGAAAAGAATGGAGTTGGG + Intergenic
1038484402 8:27923433-27923455 TGGGTGACAAGTATTGAGACAGG - Intronic
1038485814 8:27934524-27934546 TGGGTGACAAGTATTGAGACAGG - Intronic
1038845193 8:31222488-31222510 AGGGTGACAAGAATGGAGGCAGG + Intergenic
1038845943 8:31229719-31229741 TTGGAGACAAGAATGGTTGAGGG + Intergenic
1039816766 8:41101153-41101175 AGGGAGACAAGAATGAAGAGTGG - Intergenic
1040900117 8:52410010-52410032 TGGGAGTCAAGAAAGGGGGAGGG + Intronic
1041193664 8:55378694-55378716 AGAGAGACAGAAATGGAGAATGG + Intronic
1041500984 8:58538476-58538498 TGGGAGACAGAGAGGGAGAAGGG + Intergenic
1041838568 8:62244360-62244382 TGGGAGAAACCAAAGGAGAAAGG - Intergenic
1042597655 8:70466705-70466727 TGGAAGACAAGATTGGAAGAAGG - Intergenic
1042733958 8:71967099-71967121 TTGGAGACAAGAATAGACATAGG - Intronic
1043045347 8:75315880-75315902 TTGGACACAAGAATGGGAAAAGG + Intergenic
1044257368 8:90081767-90081789 AGGGAGGGAAGAAGGGAGAAAGG - Intronic
1044415062 8:91928793-91928815 TAGAAGTCAAGAAAGGAGAAGGG - Intergenic
1044426176 8:92053373-92053395 TAGGTGACAAGAATGAAAAATGG + Intronic
1044759508 8:95503145-95503167 GGGGAGGGAAGAAAGGAGAATGG - Intergenic
1044897713 8:96910344-96910366 ATGGTGACAAGGATGGAGAAAGG - Intronic
1045567856 8:103339672-103339694 TGGGAGTCAAATCTGGAGAAGGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047488584 8:125355328-125355350 AGGGAGAAAAGAGTAGAGAAGGG + Intronic
1047598533 8:126403462-126403484 TGAGAGACGAGCATGGAGAGAGG - Intergenic
1047766441 8:127993811-127993833 TGCAATACAAGAAAGGAGAAAGG - Intergenic
1047776264 8:128073342-128073364 AGGGAGAAAAGGAGGGAGAACGG - Intergenic
1047961390 8:130014592-130014614 TGGGAGCTGAGAAAGGAGAAGGG + Intronic
1048627341 8:136199749-136199771 TAGGTGACAAGAGTAGAGAAGGG + Intergenic
1048797978 8:138168954-138168976 TGGTCTACAAGACTGGAGAAGGG - Intronic
1049864658 8:144926636-144926658 GGGGCTACAAGTATGGAGAAAGG + Intergenic
1049938049 9:518374-518396 TGGGGGTCAAGGAGGGAGAAGGG - Intronic
1050443565 9:5693086-5693108 TGGGAGTAGAGAATGGAAAAAGG + Intronic
1050699744 9:8325351-8325373 GGGAAAACAAGAATGGGGAAAGG - Intronic
1050700780 9:8336332-8336354 GGGAAAACAAGAATGGGGAAAGG + Intronic
1052112375 9:24602746-24602768 TGGAAAACTAGAAAGGAGAAAGG - Intergenic
1053136816 9:35656152-35656174 TGGAAGACAAGGATGGGGAAAGG + Intergenic
1053454995 9:38227034-38227056 AGGGAGAGAAGAGTGGCGAATGG + Intergenic
1054864205 9:69983404-69983426 TGGCAGAGAAGGATGGAGAAGGG - Intergenic
1055201601 9:73669692-73669714 AGGGAGGAAAGAAAGGAGAAAGG + Intergenic
1055257268 9:74386223-74386245 TGGGAGGAAAGCATGGAGGAAGG - Intergenic
1055700552 9:78940492-78940514 AGGGAAACAAGACTGGAAAATGG - Intergenic
1055983573 9:82032106-82032128 AGGGAGACGATAAGGGAGAATGG + Intergenic
1056570204 9:87808178-87808200 TGGGAGAAAATAATAGAGACAGG + Intergenic
1057399294 9:94708649-94708671 TGGAAGACTAGAATGAACAAAGG + Intergenic
1058147921 9:101431838-101431860 AGGGAGAGAAGATTAGAGAAAGG - Intronic
1058187999 9:101877866-101877888 TTGGAGGCAACACTGGAGAATGG - Intergenic
1058343484 9:103927308-103927330 AGAGAGAGAAGAAAGGAGAAGGG + Intergenic
1058766759 9:108189455-108189477 GGGGAGCCAAGATAGGAGAAGGG + Intergenic
1059104275 9:111498293-111498315 GGGGAGAGAAGAATGGAAACAGG - Intergenic
1059280649 9:113130639-113130661 TGGGTGACAGGAAAGGTGAAGGG + Intergenic
1059326345 9:113506175-113506197 GGGGAGGCAAGCAGGGAGAAGGG + Intronic
1059560478 9:115329861-115329883 TGGGAGACATGAGTGGCTAATGG + Intronic
1059929988 9:119250912-119250934 TGGGAGAGACGAATGAGGAAAGG + Intronic
1060273405 9:122164188-122164210 TGGAAGAGAAGGAGGGAGAAAGG + Intronic
1060624720 9:125101294-125101316 TGGGAGACAAGAACGGAAGCAGG + Intronic
1061205514 9:129160911-129160933 AGGGAGAAAAGGAGGGAGAAAGG - Intergenic
1061213470 9:129206671-129206693 TGGGAGCAAAGAAAGGGGAAGGG + Intergenic
1061792872 9:133067672-133067694 TGGGAGATAAGAATAAAGAAGGG - Intronic
1061819567 9:133218812-133218834 TGGGAGACAAGGAAAGAGATAGG + Intergenic
1061890121 9:133614880-133614902 TGGGAGCAGAGAAAGGAGAATGG + Intergenic
1062241119 9:135539381-135539403 TGGGAGACAAGGAAGCAGACAGG - Intergenic
1062548475 9:137074735-137074757 AGGTAGCCAAGAATGCAGAAAGG + Intergenic
1186393698 X:9186385-9186407 AGGGAAGCAGGAATGGAGAAAGG + Intergenic
1186851646 X:13585853-13585875 TGGGGGAGCAGAATGGAGAGAGG - Intronic
1188062980 X:25623875-25623897 TGGGAGAGATGAGTGGACAAGGG - Intergenic
1188702732 X:33284631-33284653 CTGGAGACAAGAAGGGGGAAAGG - Intronic
1188984484 X:36756976-36756998 GGAGAAACAAGACTGGAGAAAGG - Intergenic
1189053144 X:37667873-37667895 GGGGAGAGAAGAAGGGAGAGAGG + Intronic
1189266834 X:39723520-39723542 GGGGAGAGGAGAATGGAGTAGGG + Intergenic
1189291686 X:39890583-39890605 TGGGACACAAGAAGGGACACAGG - Intergenic
1189535857 X:41934776-41934798 TGGGTGTCAAGAATGGAGTTGGG + Intergenic
1190022339 X:46890598-46890620 TGGGAGAAAAGACTGAAGATGGG + Intronic
1190203199 X:48381502-48381524 TGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1190207337 X:48413902-48413924 TGGGAGAAGGGAAGGGAGAAGGG + Intergenic
1191626990 X:63280334-63280356 AGGGACACAGGAAAGGAGAAGGG - Intergenic
1192491454 X:71579666-71579688 TGGGAGACAGGAGTGGGGTAGGG + Intronic
1193370900 X:80695555-80695577 AGGGAAACAAGGATGGAGGAAGG + Intronic
1196369968 X:114966566-114966588 TGGGAGATAAATATGGAGACTGG + Intergenic
1197816914 X:130507214-130507236 AGGGAGAGAAGTATGGAGAAAGG - Intergenic
1197820427 X:130536060-130536082 AGGGAGACAGGAAAGAAGAAGGG - Intergenic
1197884761 X:131206982-131207004 TGGGAGATGAGACTGCAGAAAGG - Intergenic
1198132004 X:133705132-133705154 TGAGTGAAGAGAATGGAGAATGG - Intronic
1198314664 X:135453452-135453474 TGGGACACAGGAAGGGAGTAAGG - Intergenic
1198409410 X:136350520-136350542 AGGCAGAAAAGAATGAAGAAGGG + Intronic
1198428175 X:136540454-136540476 GTGGAGACTTGAATGGAGAAAGG - Intronic
1199447567 X:147943816-147943838 TGGGAGAGAAGAAAGAAGCACGG - Intronic
1201272727 Y:12271008-12271030 AGGGAGAGAAGAAAGAAGAAAGG + Intergenic
1201992496 Y:20042989-20043011 TGGGACAGAGTAATGGAGAAAGG - Intergenic
1202048879 Y:20760639-20760661 TGGGAGAGGAGAGTGGAGAAGGG + Intronic
1202379272 Y:24261548-24261570 AGGGAGAGAAGAAGGGAGAGAGG - Intergenic
1202491510 Y:25408573-25408595 AGGGAGAGAAGAAGGGAGAGAGG + Intergenic