ID: 1026433787

View in Genome Browser
Species Human (GRCh38)
Location 7:70375320-70375342
Sequence AATTTCTTGGCTTCAGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026433787_1026433791 17 Left 1026433787 7:70375320-70375342 CCTCACTCTGAAGCCAAGAAATT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG No data
1026433787_1026433792 23 Left 1026433787 7:70375320-70375342 CCTCACTCTGAAGCCAAGAAATT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1026433792 7:70375366-70375388 AAAATGTGTGTACCTGGCAATGG 0: 1
1: 1
2: 4
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026433787 Original CRISPR AATTTCTTGGCTTCAGAGTG AGG (reversed) Intronic
904362360 1:29984693-29984715 AATGTCCTGGCTACTGAGTGTGG - Intergenic
904577640 1:31515195-31515217 AATTTCTTGGCAGGAAAGTGAGG - Intergenic
904716691 1:32473350-32473372 AATTTCTTGGCTTGAGGTTCTGG - Intronic
905328861 1:37177892-37177914 AATTTCATGGCTGCAGAGCATGG + Intergenic
906859927 1:49348540-49348562 AATTCCTTGGCTTGTGACTGCGG - Intronic
908239409 1:62176360-62176382 AATATATTGGCTGCAGAGTTAGG + Intergenic
908573287 1:65432404-65432426 AATGTCCTGGGTCCAGAGTGGGG - Exonic
908621086 1:65980623-65980645 TTTTCCTTGGCTTCAGTGTGTGG + Intronic
909482884 1:76144258-76144280 CTTTCCTTGGCCTCAGAGTGGGG - Intronic
912709025 1:111936644-111936666 AAGATCTTGGCTTCACTGTGTGG + Intronic
915795747 1:158731809-158731831 AATGTCTTGTCCTCACAGTGGGG - Intergenic
916017123 1:160760053-160760075 AATGTCTTAGCTACAGAGGGAGG - Intergenic
918523224 1:185437893-185437915 GATTTCACAGCTTCAGAGTGGGG + Intergenic
921126683 1:212184153-212184175 AGTTTCCTGGCTGCAGTGTGGGG + Intergenic
922041407 1:221902157-221902179 ATTTTGTTGTCTTTAGAGTGGGG - Intergenic
922125439 1:222716431-222716453 AACTTCTTGACTTCAGAATAAGG + Intronic
922289979 1:224201948-224201970 ATTTTCTTGGCTGCAAAATGAGG - Intergenic
924397347 1:243636362-243636384 ATTTTCTTATCTACAGAGTGGGG - Intronic
1064489951 10:15844874-15844896 ACTTTCCTGGCTTCCTAGTGAGG + Intronic
1064599431 10:16978057-16978079 TATTTCATGGCTTCAGATTTTGG + Intronic
1065414087 10:25465847-25465869 AATTTCGTGGATTGAAAGTGAGG + Intronic
1067271821 10:44798195-44798217 AATTTCTTTACTTTTGAGTGAGG - Intergenic
1068030657 10:51700393-51700415 TATTTTATGGCTTCAGAGTATGG + Intronic
1069362580 10:67659895-67659917 AATTTTTTGGCTTCACATTGAGG - Intronic
1071512007 10:86267908-86267930 GATTTCTTAGCTTCAAACTGGGG + Intronic
1074125691 10:110527382-110527404 AATTGCTTGGTTTTAGAGTTAGG + Intergenic
1075091394 10:119445920-119445942 AATTTCTGGGCTCCAGAGGAGGG - Intronic
1076262885 10:129083441-129083463 AATCACTAGGCTTCAGTGTGCGG + Intergenic
1076284055 10:129276156-129276178 CATTTCTAGGCTTGAGTGTGTGG - Intergenic
1079642631 11:22825670-22825692 AATCTATAGACTTCAGAGTGTGG + Intronic
1079675674 11:23223319-23223341 ATTTTTGTGGCTTCAGAGTATGG + Intergenic
1079678141 11:23258799-23258821 ATTATCCTGGATTCAGAGTGGGG + Intergenic
1080056170 11:27908913-27908935 GATTTCTTGGATTAAGAGTCAGG + Intergenic
1080294177 11:30706134-30706156 AATGTCATGGCTACAGAGAGAGG - Intergenic
1080558137 11:33436362-33436384 AGTCTCTTGCCTTCAGAGTTGGG - Intergenic
1080828375 11:35867298-35867320 AATTTCTTTGCTTGTTAGTGTGG - Intergenic
1081592437 11:44433926-44433948 ACCTTCTTGGCCACAGAGTGTGG + Intergenic
1082124582 11:48416782-48416804 AATTTCTAGGCTTTAAAGTGTGG + Intergenic
1082251472 11:49985959-49985981 AATTTCTAGGCTTTTAAGTGTGG - Intergenic
1082300907 11:50504573-50504595 CATTTCTTTGTTTCAGAGTTTGG - Intergenic
1082558244 11:54588024-54588046 AATTTCTAGGCTTTTAAGTGTGG + Intergenic
1084136514 11:67187334-67187356 AATTTCTTGTCTTTTGATTGGGG - Intronic
1084893981 11:72251866-72251888 AATGTCCTGGGCTCAGAGTGTGG + Intergenic
1085365501 11:75938947-75938969 AGTTTCCAGGCTTCAGAGTAGGG - Intronic
1086413731 11:86568565-86568587 AATTTACTGGCATCAGAGGGAGG + Intronic
1086420395 11:86632427-86632449 AACTTCTTGGCTGTAGTGTGAGG - Intronic
1087131093 11:94669828-94669850 AATTTCTTGAGGTCATAGTGTGG - Intergenic
1087903903 11:103673538-103673560 TATTTATTGGGTACAGAGTGTGG + Intergenic
1087933657 11:104006497-104006519 GATTTCCAGGCTTGAGAGTGGGG - Intronic
1089031091 11:115330099-115330121 GGTTTCTGGGCTTGAGAGTGGGG + Intronic
1091756621 12:3056587-3056609 ACTTTCTGGGCTTCAGAGCGTGG + Intergenic
1097756790 12:63415916-63415938 AATTTCTTGCCTTTGGGGTGAGG - Intergenic
1099090049 12:78295309-78295331 AATTTCTGGTCTTGAGAGTAAGG + Intergenic
1099195632 12:79612066-79612088 AATTTTTTGGTTTGAGAATGTGG + Intronic
1105417381 13:20225013-20225035 AGTGCCTTGGCCTCAGAGTGGGG + Intronic
1109420358 13:62103989-62104011 AATTCCTTCCTTTCAGAGTGAGG - Intergenic
1109757654 13:66782032-66782054 AACTTCTTGGATTCAGAATTTGG + Intronic
1111020907 13:82449999-82450021 AATTTCATAGATTCAGAGAGTGG - Intergenic
1111610784 13:90603787-90603809 AGTTTCTAGGCTTGAGAGTGGGG + Intergenic
1111957255 13:94773199-94773221 ACTTTCTTTACTTAAGAGTGAGG + Intergenic
1112681611 13:101773166-101773188 AAATTCTTTCCTTCTGAGTGTGG - Intronic
1113696017 13:112346092-112346114 AGTTTCTAAGCTTCAGTGTGTGG - Intergenic
1114632235 14:24166484-24166506 AAGTGCTTGGCTTTAGAGTTGGG - Exonic
1120332966 14:83116967-83116989 CATTTCTTTGCCTCAGAATGTGG + Intergenic
1120347581 14:83309726-83309748 AATTTCTTTGCTTATAAGTGGGG + Intergenic
1120633560 14:86923256-86923278 ATTTTCTTGGATTCTTAGTGTGG + Intergenic
1120770982 14:88380192-88380214 AATCTCTGTGCTTCAGAGAGGGG - Intergenic
1121467512 14:94125611-94125633 AATTTCTTAGCTTCAGCCTCTGG - Intergenic
1122024048 14:98861828-98861850 AGCTTCTTGGCTTCAAAGTTTGG - Intergenic
1123049932 14:105536314-105536336 AAGTTCTGGGCAGCAGAGTGTGG - Intergenic
1124529995 15:30497727-30497749 GGTTTCCTGGCTTCAGGGTGGGG - Intergenic
1124768664 15:32509961-32509983 GGTTTCCTGGCTTCAGGGTGGGG + Intergenic
1127147302 15:56037318-56037340 AATTTCTTTGCTTATTAGTGAGG - Intergenic
1127447229 15:59076318-59076340 ATTTACTTGGCTTAAGAGTAGGG + Intronic
1128029144 15:64463941-64463963 GATTTAGTGGCTTCAGAGTTGGG + Intronic
1128231927 15:66041356-66041378 GATTTCCTGTCTGCAGAGTGGGG + Intronic
1135476036 16:22776049-22776071 AATTTCTTGGCTTCAGGGAATGG + Intergenic
1135671933 16:24382745-24382767 CATTTGCAGGCTTCAGAGTGGGG + Intergenic
1137288554 16:47036431-47036453 AATTTCTGTGCTTAAGGGTGGGG + Intergenic
1138912196 16:61414607-61414629 AATTTCATGCCTTGAGAGTTTGG - Intergenic
1139796354 16:69486179-69486201 AGTTACTTGGCTTCCCAGTGAGG + Intergenic
1140134309 16:72191931-72191953 AATGTATTAGCTACAGAGTGGGG - Intergenic
1144018003 17:11214968-11214990 GATTTATTGGCTTCAGACTGAGG + Intergenic
1144142323 17:12361710-12361732 GAATTCTGGGCTTCAGAGAGAGG + Intergenic
1145853631 17:28129780-28129802 AATTTCTTGTCTTTATAGTTAGG + Intronic
1151333736 17:73427126-73427148 ACATTCTTTGCTTCAGAATGTGG + Intronic
1151348819 17:73519476-73519498 AATTTCCTGGCTTCAGGGCGAGG + Intronic
1158882290 18:61792057-61792079 AATTACTTGGATTCAGGGAGAGG - Intergenic
1159154519 18:64565543-64565565 AATATCTTAGTTTCAGAATGTGG - Intergenic
1163177167 19:15572448-15572470 AACTACTTGGATTGAGAGTGGGG + Intergenic
1164462024 19:28457043-28457065 AATTTCATGGCTCCACAGTTTGG + Intergenic
926328347 2:11804602-11804624 GATTTCTTTGCTTCACCGTGGGG + Intronic
926699003 2:15790312-15790334 AAGTTCCTGGCTTAAGAGTGAGG + Intergenic
927311790 2:21639763-21639785 ATTTTGTTTTCTTCAGAGTGTGG - Intergenic
929771224 2:44893761-44893783 AATTTCTTGCTTTAAGAGTATGG + Intergenic
930517781 2:52430733-52430755 TGTGTCTTTGCTTCAGAGTGGGG + Intergenic
931128895 2:59309623-59309645 TATTTCTTGCCTTCTGTGTGTGG - Intergenic
931630428 2:64293590-64293612 AATATCATGGTTTCAGAGTGTGG + Intergenic
932298641 2:70647262-70647284 AATATCCTGACTTCAGAGTTAGG - Intronic
932362426 2:71120045-71120067 AATTTTTTTCCTTCAGAGAGAGG - Intronic
933626298 2:84604365-84604387 AATGTCTTGCCTTCAAAGTCGGG - Exonic
935452359 2:103224181-103224203 TCTTTCTTAGCTACAGAGTGAGG + Intergenic
936751435 2:115647053-115647075 AATCTCTTGTCTCCAGAGTGAGG - Intronic
939326640 2:140699024-140699046 AATTTTTTTACTTCAGAGTTTGG + Intronic
940185780 2:150983768-150983790 AGTATCTGGGCTTCAGGGTGTGG + Intergenic
940613591 2:156022412-156022434 AATTTTTATGCTTCAGTGTGTGG - Intergenic
941694620 2:168537883-168537905 AAGTTCATGACTTCAGTGTGAGG - Intronic
945313626 2:208345292-208345314 AATTTCTAGGATTCAGATAGTGG + Intronic
945868655 2:215203532-215203554 AGTTTCCAGGCTTGAGAGTGGGG + Intergenic
946589547 2:221229331-221229353 AATTGCTTGGCTTGGGTGTGGGG + Intergenic
1169233688 20:3911495-3911517 AATTGCTTGAATTCAGAGGGTGG + Intronic
1170675386 20:18474848-18474870 AATTTCTTGGAATCCCAGTGTGG - Intronic
1171176975 20:23059160-23059182 GATTTCTTGGCTTCCTTGTGAGG - Intergenic
1173105360 20:40128542-40128564 AATATCCATGCTTCAGAGTGGGG + Intergenic
1174327192 20:49788863-49788885 AGTTCCTTGTCTGCAGAGTGGGG + Intergenic
1176962097 21:15170501-15170523 TAATTCTTGGATTCAGAGTATGG + Intergenic
1177516266 21:22155082-22155104 AATTTCTCAGCTTCTTAGTGTGG - Intergenic
1180695382 22:17748667-17748689 CCTTTCTTGCCTTCGGAGTGAGG - Intronic
1183196930 22:36360003-36360025 AATTTCCTAGCTTTAGAATGAGG + Intronic
1183328302 22:37206147-37206169 GATTTCTTGGGCTCAGAGTCAGG - Exonic
1183563370 22:38594509-38594531 TTTTTCTTGGCTGCAGAGTATGG + Intronic
1183718253 22:39546928-39546950 GATTTCCTGGCTTCAGAAAGGGG + Intergenic
1183985475 22:41567796-41567818 ATTTTCTTGTCTACAAAGTGGGG + Intronic
1184473877 22:44710468-44710490 AATGTCATGGCTTCTGGGTGAGG - Intronic
953511340 3:43543012-43543034 ATTCCCTTGACTTCAGAGTGAGG - Intronic
954648959 3:52148450-52148472 AATATCTTTGCTTCAGAGGAAGG - Intronic
954963053 3:54582913-54582935 AATATCTGGGCTTCAGTTTGAGG + Intronic
955065346 3:55529257-55529279 GATGTCTTGGGTTCAGAATGTGG - Intronic
955610498 3:60751540-60751562 AATTTCTTTGATTCATAGTGAGG - Intronic
958048496 3:88316520-88316542 AAGTTGTTTTCTTCAGAGTGAGG - Intergenic
958556215 3:95680491-95680513 AATTTATTGGCTTCAATGTTTGG - Intergenic
959648955 3:108733239-108733261 AATTTCCTGGTGTCAGAGGGAGG + Intergenic
962080475 3:132134157-132134179 AATTTCTGGGATTCAAAGGGTGG + Intronic
962381963 3:134905280-134905302 AATATGTCGGCTTCAGAGAGAGG - Intronic
962473448 3:135734435-135734457 AATGTCTTTGGTTTAGAGTGTGG + Intergenic
963078353 3:141368481-141368503 AGTTTCCTGGCTTCAGAGGGAGG - Intronic
964257418 3:154792093-154792115 ATTTAATTGGCTTCAGAGTTGGG + Intergenic
964521250 3:157570871-157570893 TCTTTCTTGGCCTCATAGTGGGG - Intronic
965198101 3:165624845-165624867 CAATTCTAGGCTTCAGATTGAGG - Intergenic
970488478 4:16547714-16547736 AACATCTAGGCTTCAGAGTCTGG - Intronic
970607371 4:17693221-17693243 AAATTCTTGGCTTCTCAGTTAGG + Intronic
971217435 4:24674181-24674203 AGGTTCCTGGCTTCAGAATGGGG + Intergenic
971796873 4:31239231-31239253 AATTTCCAGGCTTGAGGGTGAGG + Intergenic
972374965 4:38461280-38461302 AATTTCTACTCTTCAGAGGGAGG + Intergenic
972592911 4:40504924-40504946 AATTTTTTGTCTTCAGAGGTTGG - Intronic
973041159 4:45471910-45471932 CTTTTATTGGCCTCAGAGTGGGG - Intergenic
973730393 4:53817011-53817033 AATGTCATGGCTTCTGAGTCTGG + Intronic
974312905 4:60235123-60235145 AATTTGTTAGAATCAGAGTGTGG + Intergenic
975075665 4:70205450-70205472 AGTTGCTTGGCATGAGAGTGGGG - Intergenic
975883775 4:78940879-78940901 AAATTCTTGGCCTCAGAGTATGG + Intergenic
976238976 4:82933185-82933207 AAATTCCTGACCTCAGAGTGGGG + Intronic
976422031 4:84856164-84856186 AATTTGTTGACTTAAGAGAGAGG - Intronic
978397389 4:108295933-108295955 ATTTTCTCTGCCTCAGAGTGGGG - Intergenic
979549422 4:121974033-121974055 ATTTTCTTGGCTTCAGATGTGGG + Intergenic
981841000 4:149112029-149112051 AATTTCTTGGCATCAGGCAGAGG + Intergenic
982749423 4:159141772-159141794 CATTTCTTTGATTCTGAGTGAGG + Intronic
987570805 5:19655083-19655105 GTTTTCTAGGCTTGAGAGTGGGG + Intronic
988706036 5:33726866-33726888 ATTCACATGGCTTCAGAGTGAGG - Intronic
989181401 5:38580905-38580927 ACTTTCTAGGCTTCTGAGAGTGG + Intronic
989188874 5:38650366-38650388 ACTTTCTTTTCTTCAGAGTCAGG - Intergenic
989827328 5:45873430-45873452 AATTTTCTGGCTTCACAGTCTGG + Intergenic
990064506 5:51696188-51696210 CATTTCTTGGGTTCAGACAGTGG + Intergenic
990590383 5:57256850-57256872 ACTCTCTTAGCTTAAGAGTGGGG - Intronic
990948060 5:61270482-61270504 ACTTTCTTGGCTTCCTATTGAGG + Intergenic
992179661 5:74183871-74183893 AGTTTCCTGGCTTCAGATTCAGG - Intergenic
993372885 5:87114508-87114530 AATTACTTGGGTTCAAAGGGTGG - Intergenic
993519915 5:88888274-88888296 CTTTCCTTGGCTTCAGACTGAGG + Intronic
994095198 5:95841626-95841648 AATTTCTGGGATTCAGAGGAGGG - Intergenic
994246198 5:97480323-97480345 TATTTCTTTGCTTCACAGTATGG + Intergenic
994252639 5:97555006-97555028 AATTTTTACCCTTCAGAGTGAGG + Intergenic
994602855 5:101928806-101928828 AATTTCCTGGCTTCAAAGACAGG + Intergenic
995138836 5:108710422-108710444 AATGACATGGCTTCAGACTGAGG - Intergenic
996039912 5:118797998-118798020 TACTCCTTGGCTTCAAAGTGAGG - Intergenic
997068088 5:130586279-130586301 AATTTCTTAATTACAGAGTGTGG + Intergenic
999221375 5:149981225-149981247 AACTCTTTGGCTTCTGAGTGCGG - Exonic
1000359097 5:160431369-160431391 AGTTTCCAGGCCTCAGAGTGGGG - Intergenic
1000595645 5:163212115-163212137 AATTTCTTGAACCCAGAGTGAGG + Intergenic
1008496399 6:52138388-52138410 AATTTTTTGCCCTCAAAGTGTGG + Intergenic
1011714806 6:90094102-90094124 CTTTTCTTAGCTTCAGAATGCGG - Intronic
1012173350 6:96047283-96047305 ATTTTCGTGGCTTCTGAGAGAGG - Intronic
1015094978 6:129404815-129404837 ATTTTCTTTGCTTCAGTGTTGGG + Intronic
1015715334 6:136186527-136186549 AATTTTGTGGTTACAGAGTGAGG + Intronic
1016913233 6:149219828-149219850 AATTGCTTGTCTACAGAGTACGG - Intronic
1017892169 6:158647887-158647909 AATTTCTTGAATACAGACTGTGG + Intergenic
1026401267 7:70016006-70016028 GACTACTTGGTTTCAGAGTGAGG + Intronic
1026433787 7:70375320-70375342 AATTTCTTGGCTTCAGAGTGAGG - Intronic
1026973631 7:74482708-74482730 CATCTCCTGGCTTCAGAATGTGG + Intronic
1027900818 7:84112277-84112299 AATTTCTTGGTTTCAGCATATGG - Intronic
1028224093 7:88229633-88229655 TATATCTTGGCTTCAGGCTGTGG + Intergenic
1030387114 7:108877932-108877954 GGTTTCTAGGCTTGAGAGTGAGG - Intergenic
1030722616 7:112886781-112886803 AATTTCTTTGCCTCTGTGTGGGG - Intronic
1030781609 7:113608050-113608072 AATTTCTTAGTTTCAAAGTCAGG + Intergenic
1032732623 7:134658799-134658821 TATTCCTGTGCTTCAGAGTGAGG + Intronic
1032914925 7:136479075-136479097 AATTTCTGGAATTCAGAGTAGGG + Intergenic
1033098255 7:138449328-138449350 AATTTCTTGCCTTTTGGGTGAGG + Intergenic
1033846815 7:145443704-145443726 ATTTTCTCGGCTGCAAAGTGGGG + Intergenic
1038365064 8:26923271-26923293 AATTTCTTGGCTTCAGAAAGTGG + Intergenic
1038379307 8:27077489-27077511 AAAATGTTGGCTTCATAGTGGGG + Intergenic
1038821241 8:30953728-30953750 AATTTCTAGGCTTCAGTATTGGG + Intergenic
1039884185 8:41646086-41646108 AGTTTCTTGGCTGCAGAGCCTGG + Exonic
1040295823 8:46148563-46148585 AATTTCTTGGCTTTCGAGCACGG - Intergenic
1040594635 8:48825438-48825460 CTTTTCTTCACTTCAGAGTGGGG + Intergenic
1043484726 8:80687724-80687746 AATTCCTTGGGATCATAGTGGGG + Intronic
1043682091 8:83040957-83040979 AATTTCTTTCCTTCTGAGTGTGG + Intergenic
1047283927 8:123470190-123470212 AATTTCCAGGCTTCAGAGCTGGG + Intergenic
1049248461 8:141575501-141575523 AAGTCCTTCGCTTCTGAGTGGGG + Intergenic
1049551012 8:143259679-143259701 ATCTTCTTGCTTTCAGAGTGTGG + Intronic
1049928959 9:437850-437872 ACTTTCTTGGCTTCAGGATCAGG - Intronic
1050041796 9:1503804-1503826 AATTTCCAGGCTTGAGGGTGGGG - Intergenic
1057894491 9:98896867-98896889 AATTTCTTTGCTGCACATTGTGG - Intergenic
1059319922 9:113461590-113461612 AATATGTTAGCTGCAGAGTGGGG + Intronic
1059640125 9:116208467-116208489 AAAATCTTGGCTTTAGAGAGGGG - Intronic
1059749998 9:117238683-117238705 AGTTGCTTGACTTCAGAGAGTGG + Intronic
1060433978 9:123577178-123577200 TCTTTCTTGGCTTCATATTGAGG + Intronic
1060897693 9:127228512-127228534 AATTTCTTTGTTTCATAGTGAGG + Intronic
1185511415 X:667718-667740 AATTTCGTGGCATCATTGTGAGG - Intergenic
1186366975 X:8905914-8905936 ATTTTCTTGTCTTCAAATTGGGG - Intergenic
1187202065 X:17144699-17144721 AAATTTTTGGCTGCACAGTGGGG - Intronic
1189848770 X:45158882-45158904 AATTCCTTGGCTGCACAATGAGG - Intronic
1194418449 X:93642214-93642236 AATTTTTTGGGTACAGAGTAGGG - Intergenic
1194422993 X:93699649-93699671 AAGTTCTTGGCTCTAGATTGCGG - Intronic
1195592134 X:106641716-106641738 ATTTCCTTGGTTCCAGAGTGTGG - Intronic
1197391357 X:125869794-125869816 ATTTTCCTGGCTTCAGTGAGTGG + Intergenic
1200673104 Y:6119308-6119330 AGTTTCTGGGCTTGAGGGTGGGG - Intergenic
1201342250 Y:12947252-12947274 AATTCCTTAGTTCCAGAGTGGGG - Intergenic
1201726016 Y:17152758-17152780 AATTTCCAGGCTTGAGGGTGGGG + Intergenic